Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627874_at:

>probe:Drosophila_2:1627874_at:717:141; Interrogation_Position=1624; Antisense; ACTGTGATCCGTCAGAGTGCCGCCA
>probe:Drosophila_2:1627874_at:682:311; Interrogation_Position=1645; Antisense; GCCACCTGGGACCACAATGGACGGA
>probe:Drosophila_2:1627874_at:171:229; Interrogation_Position=1660; Antisense; AATGGACGGAAAGTGCCTGCCAAAA
>probe:Drosophila_2:1627874_at:53:491; Interrogation_Position=1686; Antisense; GTCAAATTTGGTGGGTATGCCTTCC
>probe:Drosophila_2:1627874_at:146:485; Interrogation_Position=1700; Antisense; GTATGCCTTCCAAAGAGCACGCCTA
>probe:Drosophila_2:1627874_at:193:121; Interrogation_Position=1727; Antisense; AGCGGCGCCTGGTGAGGAATACCTC
>probe:Drosophila_2:1627874_at:478:83; Interrogation_Position=1833; Antisense; AGTGGCGAGCCAGAAACTGCCTCAT
>probe:Drosophila_2:1627874_at:151:391; Interrogation_Position=1845; Antisense; GAAACTGCCTCATGTGACCAGCAAA
>probe:Drosophila_2:1627874_at:723:651; Interrogation_Position=1898; Antisense; TCAAGGATCTCGACAAGCCACGCAT
>probe:Drosophila_2:1627874_at:265:45; Interrogation_Position=2000; Antisense; ATCGCAGGAGAGCATATCCCGGCAA
>probe:Drosophila_2:1627874_at:357:407; Interrogation_Position=2046; Antisense; GACGGACGGTTACTTCCTGGCCAAG
>probe:Drosophila_2:1627874_at:676:249; Interrogation_Position=2118; Antisense; CAAGCAACCGGTGGTCAGTCCAAAG
>probe:Drosophila_2:1627874_at:258:267; Interrogation_Position=2133; Antisense; CAGTCCAAAGGTTCAGGTGCCCAGC
>probe:Drosophila_2:1627874_at:543:535; Interrogation_Position=2148; Antisense; GGTGCCCAGCGTGCTGCACAAGAAA

Paste this into a BLAST search page for me
ACTGTGATCCGTCAGAGTGCCGCCAGCCACCTGGGACCACAATGGACGGAAATGGACGGAAAGTGCCTGCCAAAAGTCAAATTTGGTGGGTATGCCTTCCGTATGCCTTCCAAAGAGCACGCCTAAGCGGCGCCTGGTGAGGAATACCTCAGTGGCGAGCCAGAAACTGCCTCATGAAACTGCCTCATGTGACCAGCAAATCAAGGATCTCGACAAGCCACGCATATCGCAGGAGAGCATATCCCGGCAAGACGGACGGTTACTTCCTGGCCAAGCAAGCAACCGGTGGTCAGTCCAAAGCAGTCCAAAGGTTCAGGTGCCCAGCGGTGCCCAGCGTGCTGCACAAGAAA

Full Affymetrix probeset data:

Annotations for 1627874_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime