FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627875_at:

>probe:Drosophila_2:1627875_at:382:67; Interrogation_Position=101; Antisense; ATGGCAGCGACCAGGTGGCTTTTAG
>probe:Drosophila_2:1627875_at:424:413; Interrogation_Position=109; Antisense; GACCAGGTGGCTTTTAGCCTCAATC
>probe:Drosophila_2:1627875_at:153:701; Interrogation_Position=120; Antisense; TTTTAGCCTCAATCTGTGGGCCAAA
>probe:Drosophila_2:1627875_at:269:237; Interrogation_Position=130; Antisense; AATCTGTGGGCCAAACAGGGCGCCA
>probe:Drosophila_2:1627875_at:666:179; Interrogation_Position=142; Antisense; AAACAGGGCGCCAGTGACTATTGTG
>probe:Drosophila_2:1627875_at:212:267; Interrogation_Position=153; Antisense; CAGTGACTATTGTGGCATCCTGGTC
>probe:Drosophila_2:1627875_at:393:521; Interrogation_Position=164; Antisense; GTGGCATCCTGGTCAGCAACGTGAG
>probe:Drosophila_2:1627875_at:258:649; Interrogation_Position=176; Antisense; TCAGCAACGTGAGTGGGAGCAATGT
>probe:Drosophila_2:1627875_at:642:361; Interrogation_Position=194; Antisense; GCAATGTAAGCATAACATCCGCGCT
>probe:Drosophila_2:1627875_at:81:657; Interrogation_Position=200; Antisense; TAAGCATAACATCCGCGCTTCTCTA
>probe:Drosophila_2:1627875_at:180:249; Interrogation_Position=21; Antisense; CAAGGTGAAGATGAGCTCCGGCTAC
>probe:Drosophila_2:1627875_at:476:533; Interrogation_Position=24; Antisense; GGTGAAGATGAGCTCCGGCTACACA
>probe:Drosophila_2:1627875_at:672:403; Interrogation_Position=67; Antisense; GACTACCGCACTCCGGGCTGCATGG
>probe:Drosophila_2:1627875_at:683:297; Interrogation_Position=73; Antisense; CGCACTCCGGGCTGCATGGCCATGG

Paste this into a BLAST search page for me
ATGGCAGCGACCAGGTGGCTTTTAGGACCAGGTGGCTTTTAGCCTCAATCTTTTAGCCTCAATCTGTGGGCCAAAAATCTGTGGGCCAAACAGGGCGCCAAAACAGGGCGCCAGTGACTATTGTGCAGTGACTATTGTGGCATCCTGGTCGTGGCATCCTGGTCAGCAACGTGAGTCAGCAACGTGAGTGGGAGCAATGTGCAATGTAAGCATAACATCCGCGCTTAAGCATAACATCCGCGCTTCTCTACAAGGTGAAGATGAGCTCCGGCTACGGTGAAGATGAGCTCCGGCTACACAGACTACCGCACTCCGGGCTGCATGGCGCACTCCGGGCTGCATGGCCATGG

Full Affymetrix probeset data:

Annotations for 1627875_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720