FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627876_at:

>probe:Drosophila_2:1627876_at:268:147; Interrogation_Position=367; Antisense; ACTTCCGACTTGATTGCCAATCCCA
>probe:Drosophila_2:1627876_at:14:551; Interrogation_Position=403; Antisense; GGAGTAGAGCGTTTGGTCACCCATT
>probe:Drosophila_2:1627876_at:709:281; Interrogation_Position=462; Antisense; CTCGTGCTCCGAATCAATGTATTGC
>probe:Drosophila_2:1627876_at:660:457; Interrogation_Position=534; Antisense; GATATGCGCCGATGATGCGGACTTA
>probe:Drosophila_2:1627876_at:700:123; Interrogation_Position=569; Antisense; AGCCGGAACCGGATGTCTATTTAAT
>probe:Drosophila_2:1627876_at:417:427; Interrogation_Position=611; Antisense; GAGATGCCGGACCAGATTGCACCCT
>probe:Drosophila_2:1627876_at:82:283; Interrogation_Position=650; Antisense; CTCCTAAGGGAGTCCAGGCAGCGAC
>probe:Drosophila_2:1627876_at:196:51; Interrogation_Position=677; Antisense; ATGCCCGACTGCCAGTGGTAATGTT
>probe:Drosophila_2:1627876_at:203:103; Interrogation_Position=732; Antisense; AGAGCTGGCCACTTTACGTTTGGAA
>probe:Drosophila_2:1627876_at:323:717; Interrogation_Position=769; Antisense; TTCGACCCGGCGGAGTTCAACATGC
>probe:Drosophila_2:1627876_at:495:199; Interrogation_Position=827; Antisense; AACCGAAGGCTTCAAGTCATCGTAG
>probe:Drosophila_2:1627876_at:504:1; Interrogation_Position=841; Antisense; AGTCATCGTAGCTCCCAAAAATCTG
>probe:Drosophila_2:1627876_at:75:531; Interrogation_Position=879; Antisense; GGGTTCCGCTGCACTAAAGAAAGCT
>probe:Drosophila_2:1627876_at:307:207; Interrogation_Position=899; Antisense; AAGCTGCTGCGGATTCAGAAGCTGA

Paste this into a BLAST search page for me
ACTTCCGACTTGATTGCCAATCCCAGGAGTAGAGCGTTTGGTCACCCATTCTCGTGCTCCGAATCAATGTATTGCGATATGCGCCGATGATGCGGACTTAAGCCGGAACCGGATGTCTATTTAATGAGATGCCGGACCAGATTGCACCCTCTCCTAAGGGAGTCCAGGCAGCGACATGCCCGACTGCCAGTGGTAATGTTAGAGCTGGCCACTTTACGTTTGGAATTCGACCCGGCGGAGTTCAACATGCAACCGAAGGCTTCAAGTCATCGTAGAGTCATCGTAGCTCCCAAAAATCTGGGGTTCCGCTGCACTAAAGAAAGCTAAGCTGCTGCGGATTCAGAAGCTGA

Full Affymetrix probeset data:

Annotations for 1627876_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720