FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627880_at:

>probe:Drosophila_2:1627880_at:3:335; Interrogation_Position=115; Antisense; GCTGCAGACAGTTCAATCCGTTCTA
>probe:Drosophila_2:1627880_at:98:473; Interrogation_Position=134; Antisense; GTTCTACATTGGACCCTATCCGGAG
>probe:Drosophila_2:1627880_at:658:327; Interrogation_Position=169; Antisense; GCGATTGTCCGTATGGCGAGTACTC
>probe:Drosophila_2:1627880_at:509:669; Interrogation_Position=189; Antisense; TACTCGGGCTTCACCAGATGCGGAT
>probe:Drosophila_2:1627880_at:627:265; Interrogation_Position=326; Antisense; CAGAGGTGGTTGTGCGCCATCTTGT
>probe:Drosophila_2:1627880_at:352:37; Interrogation_Position=344; Antisense; ATCTTGTGGTCCTCGTGGCGGATCG
>probe:Drosophila_2:1627880_at:477:507; Interrogation_Position=398; Antisense; GTGCTATCAATTTCCGTACGGAGCG
>probe:Drosophila_2:1627880_at:33:559; Interrogation_Position=422; Antisense; GGACAGCTGCATGATGTGCTCCAGT
>probe:Drosophila_2:1627880_at:316:509; Interrogation_Position=437; Antisense; GTGCTCCAGTGGATTTGGCTGCTGT
>probe:Drosophila_2:1627880_at:530:621; Interrogation_Position=495; Antisense; TGCTGAGCATGTACGTCTCGTGGAC
>probe:Drosophila_2:1627880_at:138:639; Interrogation_Position=520; Antisense; TCTGGACTTCACTGTTTGCGGTTAA
>probe:Drosophila_2:1627880_at:54:243; Interrogation_Position=58; Antisense; AATAGAGGAGCTCACTGGCCGCGCA
>probe:Drosophila_2:1627880_at:703:577; Interrogation_Position=74; Antisense; GGCCGCGCACAGTGAAGTCCAGAAT
>probe:Drosophila_2:1627880_at:220:505; Interrogation_Position=90; Antisense; GTCCAGAATCCAGCTAACATGTCCA

Paste this into a BLAST search page for me
GCTGCAGACAGTTCAATCCGTTCTAGTTCTACATTGGACCCTATCCGGAGGCGATTGTCCGTATGGCGAGTACTCTACTCGGGCTTCACCAGATGCGGATCAGAGGTGGTTGTGCGCCATCTTGTATCTTGTGGTCCTCGTGGCGGATCGGTGCTATCAATTTCCGTACGGAGCGGGACAGCTGCATGATGTGCTCCAGTGTGCTCCAGTGGATTTGGCTGCTGTTGCTGAGCATGTACGTCTCGTGGACTCTGGACTTCACTGTTTGCGGTTAAAATAGAGGAGCTCACTGGCCGCGCAGGCCGCGCACAGTGAAGTCCAGAATGTCCAGAATCCAGCTAACATGTCCA

Full Affymetrix probeset data:

Annotations for 1627880_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720