Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627881_at:

>probe:Drosophila_2:1627881_at:116:393; Interrogation_Position=5539; Antisense; GAAATCCAAACGCTTTGCTTTCGAG
>probe:Drosophila_2:1627881_at:592:339; Interrogation_Position=5555; Antisense; GCTTTCGAGTTTGGGTTACGAGCTA
>probe:Drosophila_2:1627881_at:567:157; Interrogation_Position=5648; Antisense; ACAAATTACGATTGCAGTGGCCGGG
>probe:Drosophila_2:1627881_at:467:379; Interrogation_Position=5694; Antisense; GAAGCCCCAGCAAAATGCTTTCCAT
>probe:Drosophila_2:1627881_at:443:233; Interrogation_Position=5707; Antisense; AATGCTTTCCATATCACAGATGAAG
>probe:Drosophila_2:1627881_at:281:147; Interrogation_Position=5846; Antisense; ACACTCTAATTTCACTTCATTGGAA
>probe:Drosophila_2:1627881_at:507:369; Interrogation_Position=5868; Antisense; GAAGGAAGGATTAACCCCTAGCGAT
>probe:Drosophila_2:1627881_at:700:703; Interrogation_Position=5878; Antisense; TTAACCCCTAGCGATAAGTAAGTCT
>probe:Drosophila_2:1627881_at:136:493; Interrogation_Position=5895; Antisense; GTAAGTCTATGAGCGATCGTACATG
>probe:Drosophila_2:1627881_at:30:451; Interrogation_Position=5909; Antisense; GATCGTACATGTATTGATTACCACA
>probe:Drosophila_2:1627881_at:440:665; Interrogation_Position=5943; Antisense; TACACGGATGCCAATGTATCCCACT
>probe:Drosophila_2:1627881_at:460:45; Interrogation_Position=5960; Antisense; ATCCCACTCTGTTCGTAAGCATTAA
>probe:Drosophila_2:1627881_at:195:493; Interrogation_Position=5974; Antisense; GTAAGCATTAAGCATAGTCTCATAA
>probe:Drosophila_2:1627881_at:505:645; Interrogation_Position=5993; Antisense; TCATAATTTATTACGCAAGCCCAAG

Paste this into a BLAST search page for me
GAAATCCAAACGCTTTGCTTTCGAGGCTTTCGAGTTTGGGTTACGAGCTAACAAATTACGATTGCAGTGGCCGGGGAAGCCCCAGCAAAATGCTTTCCATAATGCTTTCCATATCACAGATGAAGACACTCTAATTTCACTTCATTGGAAGAAGGAAGGATTAACCCCTAGCGATTTAACCCCTAGCGATAAGTAAGTCTGTAAGTCTATGAGCGATCGTACATGGATCGTACATGTATTGATTACCACATACACGGATGCCAATGTATCCCACTATCCCACTCTGTTCGTAAGCATTAAGTAAGCATTAAGCATAGTCTCATAATCATAATTTATTACGCAAGCCCAAG

Full Affymetrix probeset data:

Annotations for 1627881_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime