Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627882_at:

>probe:Drosophila_2:1627882_at:452:347; Interrogation_Position=2006; Antisense; GCATGTTACACTGCAACCGCATTTT
>probe:Drosophila_2:1627882_at:150:617; Interrogation_Position=2017; Antisense; TGCAACCGCATTTTCAGCTTAATTA
>probe:Drosophila_2:1627882_at:286:115; Interrogation_Position=2032; Antisense; AGCTTAATTATTCATGTGGCACGGA
>probe:Drosophila_2:1627882_at:420:165; Interrogation_Position=2083; Antisense; AAATCGCCATTGGTGAGGCCAGTGT
>probe:Drosophila_2:1627882_at:627:577; Interrogation_Position=2099; Antisense; GGCCAGTGTAATTGGGAGCACGCCA
>probe:Drosophila_2:1627882_at:306:553; Interrogation_Position=2113; Antisense; GGAGCACGCCAGTGTATTTATCCGC
>probe:Drosophila_2:1627882_at:153:689; Interrogation_Position=2127; Antisense; TATTTATCCGCCTTTTTGCCCATTT
>probe:Drosophila_2:1627882_at:497:625; Interrogation_Position=2143; Antisense; TGCCCATTTTCCTGGCTTTTTAACG
>probe:Drosophila_2:1627882_at:664:709; Interrogation_Position=2181; Antisense; TTAAGACGCTTAAGGCGCTCGGCCT
>probe:Drosophila_2:1627882_at:26:579; Interrogation_Position=2201; Antisense; GGCCTTCTCGCTTTTGTGGGCCAAG
>probe:Drosophila_2:1627882_at:87:337; Interrogation_Position=2263; Antisense; GCTCGTTGTAGCTAAACTGGCCAGA
>probe:Drosophila_2:1627882_at:638:311; Interrogation_Position=2325; Antisense; GCCAACGGGCGTAACACATTTTCTT
>probe:Drosophila_2:1627882_at:560:389; Interrogation_Position=2541; Antisense; GAAACATACCATGTGAACCCCATTT
>probe:Drosophila_2:1627882_at:505:243; Interrogation_Position=2570; Antisense; AATATACATACATTTTGCGCTTCTT

Paste this into a BLAST search page for me
GCATGTTACACTGCAACCGCATTTTTGCAACCGCATTTTCAGCTTAATTAAGCTTAATTATTCATGTGGCACGGAAAATCGCCATTGGTGAGGCCAGTGTGGCCAGTGTAATTGGGAGCACGCCAGGAGCACGCCAGTGTATTTATCCGCTATTTATCCGCCTTTTTGCCCATTTTGCCCATTTTCCTGGCTTTTTAACGTTAAGACGCTTAAGGCGCTCGGCCTGGCCTTCTCGCTTTTGTGGGCCAAGGCTCGTTGTAGCTAAACTGGCCAGAGCCAACGGGCGTAACACATTTTCTTGAAACATACCATGTGAACCCCATTTAATATACATACATTTTGCGCTTCTT

Full Affymetrix probeset data:

Annotations for 1627882_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime