Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627884_at:

>probe:Drosophila_2:1627884_at:185:287; Interrogation_Position=1020; Antisense; CTGGTCGTTGTACTGGGCGTATTCA
>probe:Drosophila_2:1627884_at:545:327; Interrogation_Position=1036; Antisense; GCGTATTCAGCTTCCTGGGCCAGAT
>probe:Drosophila_2:1627884_at:469:619; Interrogation_Position=1063; Antisense; TGCTCACGCTATCGCTGCAGATCGA
>probe:Drosophila_2:1627884_at:541:617; Interrogation_Position=1078; Antisense; TGCAGATCGAACAGGCCGGACCAGT
>probe:Drosophila_2:1627884_at:461:641; Interrogation_Position=1141; Antisense; TCTGGCAGATGCTCTTCTTCGGAGA
>probe:Drosophila_2:1627884_at:132:451; Interrogation_Position=1210; Antisense; GATCTGTGGTTCTGACGGCCCTGAA
>probe:Drosophila_2:1627884_at:383:335; Interrogation_Position=1268; Antisense; GCTGCGGAAGCGATTCAGGCTCATC
>probe:Drosophila_2:1627884_at:595:267; Interrogation_Position=1283; Antisense; CAGGCTCATCCTGCTGGAATAGTGT
>probe:Drosophila_2:1627884_at:77:361; Interrogation_Position=1377; Antisense; GCAAGCATCAGTGGCCGGCAGCAAA
>probe:Drosophila_2:1627884_at:124:175; Interrogation_Position=1399; Antisense; AAACCCGGTTCATTCATCGTAGACT
>probe:Drosophila_2:1627884_at:516:103; Interrogation_Position=1419; Antisense; AGACTCTACTTATATCAAGGCTCAG
>probe:Drosophila_2:1627884_at:249:371; Interrogation_Position=1469; Antisense; GAAGGGACGCGTGATATCCACTCCA
>probe:Drosophila_2:1627884_at:49:699; Interrogation_Position=1521; Antisense; TTTAGTTTAGCCAATTTCGCCGATT
>probe:Drosophila_2:1627884_at:535:717; Interrogation_Position=1536; Antisense; TTCGCCGATTTGTTGTTTTGTACAT

Paste this into a BLAST search page for me
CTGGTCGTTGTACTGGGCGTATTCAGCGTATTCAGCTTCCTGGGCCAGATTGCTCACGCTATCGCTGCAGATCGATGCAGATCGAACAGGCCGGACCAGTTCTGGCAGATGCTCTTCTTCGGAGAGATCTGTGGTTCTGACGGCCCTGAAGCTGCGGAAGCGATTCAGGCTCATCCAGGCTCATCCTGCTGGAATAGTGTGCAAGCATCAGTGGCCGGCAGCAAAAAACCCGGTTCATTCATCGTAGACTAGACTCTACTTATATCAAGGCTCAGGAAGGGACGCGTGATATCCACTCCATTTAGTTTAGCCAATTTCGCCGATTTTCGCCGATTTGTTGTTTTGTACAT

Full Affymetrix probeset data:

Annotations for 1627884_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime