FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627886_at:

>probe:Drosophila_2:1627886_at:18:117; Interrogation_Position=2811; Antisense; AGCTAAAGCCGTCGTCCAATGTGAA
>probe:Drosophila_2:1627886_at:293:107; Interrogation_Position=2835; Antisense; AGAATGCTTTGCTCACCATGAACGC
>probe:Drosophila_2:1627886_at:14:615; Interrogation_Position=2853; Antisense; TGAACGCCAAATACCGGAGCATGCT
>probe:Drosophila_2:1627886_at:342:305; Interrogation_Position=2866; Antisense; CCGGAGCATGCTGTTCGAATCGAAA
>probe:Drosophila_2:1627886_at:617:269; Interrogation_Position=2935; Antisense; CATAACGGCGGACAAGATTCTCTAT
>probe:Drosophila_2:1627886_at:630:461; Interrogation_Position=2950; Antisense; GATTCTCTATGACTACGCACTGGAT
>probe:Drosophila_2:1627886_at:456:363; Interrogation_Position=3019; Antisense; GAATTGCTTCGAACGTTACAACACG
>probe:Drosophila_2:1627886_at:706:707; Interrogation_Position=3034; Antisense; TTACAACACGGCACACATTCTGCTT
>probe:Drosophila_2:1627886_at:11:275; Interrogation_Position=3049; Antisense; CATTCTGCTTCATTCGTTGGTGCAA
>probe:Drosophila_2:1627886_at:627:161; Interrogation_Position=3110; Antisense; AAATATCGCGATGCCGTTGAGAAGC
>probe:Drosophila_2:1627886_at:275:367; Interrogation_Position=3181; Antisense; GAATGCTTAGTTACTCGGGCGGATA
>probe:Drosophila_2:1627886_at:660:19; Interrogation_Position=3211; Antisense; ATATTCCAACCATGAAGCACCGGCA
>probe:Drosophila_2:1627886_at:428:649; Interrogation_Position=3271; Antisense; TCACCGTTTTCGTTGGGAGTGCAAA
>probe:Drosophila_2:1627886_at:629:151; Interrogation_Position=3364; Antisense; ACACCTAATTTCTGGCCTTCAAAGT

Paste this into a BLAST search page for me
AGCTAAAGCCGTCGTCCAATGTGAAAGAATGCTTTGCTCACCATGAACGCTGAACGCCAAATACCGGAGCATGCTCCGGAGCATGCTGTTCGAATCGAAACATAACGGCGGACAAGATTCTCTATGATTCTCTATGACTACGCACTGGATGAATTGCTTCGAACGTTACAACACGTTACAACACGGCACACATTCTGCTTCATTCTGCTTCATTCGTTGGTGCAAAAATATCGCGATGCCGTTGAGAAGCGAATGCTTAGTTACTCGGGCGGATAATATTCCAACCATGAAGCACCGGCATCACCGTTTTCGTTGGGAGTGCAAAACACCTAATTTCTGGCCTTCAAAGT

Full Affymetrix probeset data:

Annotations for 1627886_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720