FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627888_at:

>probe:Drosophila_2:1627888_at:235:483; Interrogation_Position=1476; Antisense; GTATAGTTATCAGCGCATGTTGAAT
>probe:Drosophila_2:1627888_at:677:515; Interrogation_Position=1505; Antisense; GTGGGCAGTGCGACTCAAACATTAT
>probe:Drosophila_2:1627888_at:541:695; Interrogation_Position=1535; Antisense; TTTAGTATACTACGGCGCCACAATA
>probe:Drosophila_2:1627888_at:667:369; Interrogation_Position=1577; Antisense; GAATGTCCCCTCCAAGAGCTAAGTA
>probe:Drosophila_2:1627888_at:615:459; Interrogation_Position=1615; Antisense; GATTTTCAGTTGTACTTTCCGAATT
>probe:Drosophila_2:1627888_at:255:483; Interrogation_Position=1661; Antisense; GTATTTGTTGAAATGCGTTCGGCAT
>probe:Drosophila_2:1627888_at:424:293; Interrogation_Position=1676; Antisense; CGTTCGGCATTCATTCCAATTCTAT
>probe:Drosophila_2:1627888_at:71:363; Interrogation_Position=1728; Antisense; GCAATAGTCCATATCGAGGAGCATT
>probe:Drosophila_2:1627888_at:630:653; Interrogation_Position=1853; Antisense; TAATTCTGACTGACATTTCCATGGA
>probe:Drosophila_2:1627888_at:540:17; Interrogation_Position=1867; Antisense; ATTTCCATGGACATTCCGCCGTGCG
>probe:Drosophila_2:1627888_at:220:631; Interrogation_Position=1881; Antisense; TCCGCCGTGCGGTGGAAGTGCATTT
>probe:Drosophila_2:1627888_at:298:729; Interrogation_Position=1904; Antisense; TTGGTGAATCGTTTTTGCCACAGTT
>probe:Drosophila_2:1627888_at:243:7; Interrogation_Position=2011; Antisense; ATTCCGGTTGGATGGGTACTTATCA
>probe:Drosophila_2:1627888_at:583:685; Interrogation_Position=2031; Antisense; TATCATTCGTTTTTTGTTGGGTACA

Paste this into a BLAST search page for me
GTATAGTTATCAGCGCATGTTGAATGTGGGCAGTGCGACTCAAACATTATTTTAGTATACTACGGCGCCACAATAGAATGTCCCCTCCAAGAGCTAAGTAGATTTTCAGTTGTACTTTCCGAATTGTATTTGTTGAAATGCGTTCGGCATCGTTCGGCATTCATTCCAATTCTATGCAATAGTCCATATCGAGGAGCATTTAATTCTGACTGACATTTCCATGGAATTTCCATGGACATTCCGCCGTGCGTCCGCCGTGCGGTGGAAGTGCATTTTTGGTGAATCGTTTTTGCCACAGTTATTCCGGTTGGATGGGTACTTATCATATCATTCGTTTTTTGTTGGGTACA

Full Affymetrix probeset data:

Annotations for 1627888_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720