FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627890_at:

>probe:Drosophila_2:1627890_at:371:117; Interrogation_Position=117; Antisense; AGCTAGGGAGCAATTCACGCCGGAA
>probe:Drosophila_2:1627890_at:219:135; Interrogation_Position=175; Antisense; ACGCTGCACGACCATGGATTTGCTT
>probe:Drosophila_2:1627890_at:528:85; Interrogation_Position=206; Antisense; AGTCGCGGGCGATTATGGTTTATCT
>probe:Drosophila_2:1627890_at:688:207; Interrogation_Position=256; Antisense; AAGCTCTTCCCCAAGGATGTGCAAA
>probe:Drosophila_2:1627890_at:379:531; Interrogation_Position=318; Antisense; GGGTACGCTGTATAAGAGCTTCTCC
>probe:Drosophila_2:1627890_at:329:417; Interrogation_Position=333; Antisense; GAGCTTCTCCGAGTACTATTATCCG
>probe:Drosophila_2:1627890_at:678:457; Interrogation_Position=360; Antisense; GATTTTCCTAAAGAAGCCCGCCAAT
>probe:Drosophila_2:1627890_at:151:371; Interrogation_Position=406; Antisense; GAAGTGGCCTTCGAATTCCTAAACA
>probe:Drosophila_2:1627890_at:595:319; Interrogation_Position=47; Antisense; GCCGCTCTGTTCTGATGACAGCCAA
>probe:Drosophila_2:1627890_at:108:677; Interrogation_Position=471; Antisense; TAGCTTGGCGGATATTGCCTTTCTG
>probe:Drosophila_2:1627890_at:479:293; Interrogation_Position=513; Antisense; CGATGTGGCTGGCTTCGATTTCAAG
>probe:Drosophila_2:1627890_at:457:17; Interrogation_Position=530; Antisense; ATTTCAAGCGGTATGCCAATGTGGC
>probe:Drosophila_2:1627890_at:639:573; Interrogation_Position=606; Antisense; GGCTGGTTGCCAGGAGTTCCGCAAA
>probe:Drosophila_2:1627890_at:712:107; Interrogation_Position=95; Antisense; AGAAGACCATTATCAACACCCGAGC

Paste this into a BLAST search page for me
AGCTAGGGAGCAATTCACGCCGGAAACGCTGCACGACCATGGATTTGCTTAGTCGCGGGCGATTATGGTTTATCTAAGCTCTTCCCCAAGGATGTGCAAAGGGTACGCTGTATAAGAGCTTCTCCGAGCTTCTCCGAGTACTATTATCCGGATTTTCCTAAAGAAGCCCGCCAATGAAGTGGCCTTCGAATTCCTAAACAGCCGCTCTGTTCTGATGACAGCCAATAGCTTGGCGGATATTGCCTTTCTGCGATGTGGCTGGCTTCGATTTCAAGATTTCAAGCGGTATGCCAATGTGGCGGCTGGTTGCCAGGAGTTCCGCAAAAGAAGACCATTATCAACACCCGAGC

Full Affymetrix probeset data:

Annotations for 1627890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720