FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627891_at:

>probe:Drosophila_2:1627891_at:722:597; Interrogation_Position=149; Antisense; TGTCCTACAAGGGTCGCGAGCTGTC
>probe:Drosophila_2:1627891_at:556:325; Interrogation_Position=164; Antisense; GCGAGCTGTCCAATCAGAGCATACT
>probe:Drosophila_2:1627891_at:462:63; Interrogation_Position=194; Antisense; ATGTGGGCCATAAGTCCATTCTGGA
>probe:Drosophila_2:1627891_at:329:285; Interrogation_Position=241; Antisense; CTGACGCCCAAGCAATTGCGCGAAA
>probe:Drosophila_2:1627891_at:109:465; Interrogation_Position=270; Antisense; GATTGGCAAGTTTAGCAAGTTCGGC
>probe:Drosophila_2:1627891_at:297:59; Interrogation_Position=325; Antisense; ATGTCTACATTGATCGGCGGTTACC
>probe:Drosophila_2:1627891_at:152:575; Interrogation_Position=340; Antisense; GGCGGTTACCAGCAACGCATAGATC
>probe:Drosophila_2:1627891_at:504:565; Interrogation_Position=390; Antisense; GGCACAGGACTTGACTGAACTCGAT
>probe:Drosophila_2:1627891_at:504:383; Interrogation_Position=406; Antisense; GAACTCGATTTGTTGTCCCTTAACT
>probe:Drosophila_2:1627891_at:730:193; Interrogation_Position=427; Antisense; AACTCCGATGATTCACTGGTCAACA
>probe:Drosophila_2:1627891_at:100:253; Interrogation_Position=450; Antisense; CAACCAGACGGAGCTAGAGCCGATT
>probe:Drosophila_2:1627891_at:712:415; Interrogation_Position=466; Antisense; GAGCCGATTGCTCCATTGAATTTCT
>probe:Drosophila_2:1627891_at:629:307; Interrogation_Position=478; Antisense; CCATTGAATTTCTCTGGATCTGATT
>probe:Drosophila_2:1627891_at:143:699; Interrogation_Position=62; Antisense; TTTACGATGTGGATCGCTTCGGAAC

Paste this into a BLAST search page for me
TGTCCTACAAGGGTCGCGAGCTGTCGCGAGCTGTCCAATCAGAGCATACTATGTGGGCCATAAGTCCATTCTGGACTGACGCCCAAGCAATTGCGCGAAAGATTGGCAAGTTTAGCAAGTTCGGCATGTCTACATTGATCGGCGGTTACCGGCGGTTACCAGCAACGCATAGATCGGCACAGGACTTGACTGAACTCGATGAACTCGATTTGTTGTCCCTTAACTAACTCCGATGATTCACTGGTCAACACAACCAGACGGAGCTAGAGCCGATTGAGCCGATTGCTCCATTGAATTTCTCCATTGAATTTCTCTGGATCTGATTTTTACGATGTGGATCGCTTCGGAAC

Full Affymetrix probeset data:

Annotations for 1627891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720