FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627893_at:

>probe:Drosophila_2:1627893_at:582:229; Interrogation_Position=1706; Antisense; AATGTTAGGCAACACCTCCGCAGAA
>probe:Drosophila_2:1627893_at:114:129; Interrogation_Position=1719; Antisense; ACCTCCGCAGAATCATTACGTTTTT
>probe:Drosophila_2:1627893_at:457:95; Interrogation_Position=1872; Antisense; AGATATCTATCTGTTCACTACTGCT
>probe:Drosophila_2:1627893_at:225:367; Interrogation_Position=1923; Antisense; GAATCGAGCTGTAACCGAGTGATTT
>probe:Drosophila_2:1627893_at:664:83; Interrogation_Position=1940; Antisense; AGTGATTTGGAATTAGCATAGCCCC
>probe:Drosophila_2:1627893_at:614:703; Interrogation_Position=1966; Antisense; TTATCTTTTGAATGTAGCCCGTGTG
>probe:Drosophila_2:1627893_at:317:123; Interrogation_Position=1981; Antisense; AGCCCGTGTGTATGTTTTTCCTAAG
>probe:Drosophila_2:1627893_at:37:95; Interrogation_Position=2011; Antisense; AGTTCCACGCACAAGACAGTCATTT
>probe:Drosophila_2:1627893_at:108:99; Interrogation_Position=2059; Antisense; AGATGCTCATGCTTTAATGCTTAAT
>probe:Drosophila_2:1627893_at:367:395; Interrogation_Position=2088; Antisense; GAAATCTGCACGTAAATAGCTTTGA
>probe:Drosophila_2:1627893_at:412:21; Interrogation_Position=2129; Antisense; ATATCTATCCAGTTGAATACCCGAA
>probe:Drosophila_2:1627893_at:684:695; Interrogation_Position=2161; Antisense; TTTAAATTCAAATCCCGTTCGCTGT
>probe:Drosophila_2:1627893_at:515:633; Interrogation_Position=2173; Antisense; TCCCGTTCGCTGTTTCTATAGTATT
>probe:Drosophila_2:1627893_at:396:53; Interrogation_Position=2214; Antisense; ATGCATATTGTTTCGCAGCTAAATC

Paste this into a BLAST search page for me
AATGTTAGGCAACACCTCCGCAGAAACCTCCGCAGAATCATTACGTTTTTAGATATCTATCTGTTCACTACTGCTGAATCGAGCTGTAACCGAGTGATTTAGTGATTTGGAATTAGCATAGCCCCTTATCTTTTGAATGTAGCCCGTGTGAGCCCGTGTGTATGTTTTTCCTAAGAGTTCCACGCACAAGACAGTCATTTAGATGCTCATGCTTTAATGCTTAATGAAATCTGCACGTAAATAGCTTTGAATATCTATCCAGTTGAATACCCGAATTTAAATTCAAATCCCGTTCGCTGTTCCCGTTCGCTGTTTCTATAGTATTATGCATATTGTTTCGCAGCTAAATC

Full Affymetrix probeset data:

Annotations for 1627893_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720