FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627898_at:

>probe:Drosophila_2:1627898_at:464:543; Interrogation_Position=1012; Antisense; GGATTCACAGATGGACTGCCGCACC
>probe:Drosophila_2:1627898_at:59:435; Interrogation_Position=1037; Antisense; GAGGGTGACTCCAACATCGACACAG
>probe:Drosophila_2:1627898_at:318:197; Interrogation_Position=1091; Antisense; AACGATGAAATCGAGCTCGTCTTCA
>probe:Drosophila_2:1627898_at:642:43; Interrogation_Position=1122; Antisense; ATCCCACGGAGATGTCGGCGGACAA
>probe:Drosophila_2:1627898_at:169:573; Interrogation_Position=1138; Antisense; GGCGGACAACCAGCTCATACGGGCA
>probe:Drosophila_2:1627898_at:65:77; Interrogation_Position=1167; Antisense; AGGAGAACTGTGTGCGCTACATCAA
>probe:Drosophila_2:1627898_at:457:321; Interrogation_Position=1180; Antisense; GCGCTACATCAAGACCACGGCAAAT
>probe:Drosophila_2:1627898_at:550:261; Interrogation_Position=1207; Antisense; CACCGTCGATCATCTCAGCAAGTAT
>probe:Drosophila_2:1627898_at:350:649; Interrogation_Position=1221; Antisense; TCAGCAAGTATCTGGCCATGCGGCT
>probe:Drosophila_2:1627898_at:336:627; Interrogation_Position=1269; Antisense; TGCCAGAGGCTTGTCGCGTGCTCAA
>probe:Drosophila_2:1627898_at:431:509; Interrogation_Position=1286; Antisense; GTGCTCAACTTTTGCATCTACGTCG
>probe:Drosophila_2:1627898_at:255:313; Interrogation_Position=1318; Antisense; GCCACAGCAGTTGGTTATCCTGAAT
>probe:Drosophila_2:1627898_at:551:669; Interrogation_Position=1333; Antisense; TATCCTGAATGGCAACCAGACGTTG
>probe:Drosophila_2:1627898_at:401:481; Interrogation_Position=1448; Antisense; GTATTAGGCCGTTTATTTCTGAAAT

Paste this into a BLAST search page for me
GGATTCACAGATGGACTGCCGCACCGAGGGTGACTCCAACATCGACACAGAACGATGAAATCGAGCTCGTCTTCAATCCCACGGAGATGTCGGCGGACAAGGCGGACAACCAGCTCATACGGGCAAGGAGAACTGTGTGCGCTACATCAAGCGCTACATCAAGACCACGGCAAATCACCGTCGATCATCTCAGCAAGTATTCAGCAAGTATCTGGCCATGCGGCTTGCCAGAGGCTTGTCGCGTGCTCAAGTGCTCAACTTTTGCATCTACGTCGGCCACAGCAGTTGGTTATCCTGAATTATCCTGAATGGCAACCAGACGTTGGTATTAGGCCGTTTATTTCTGAAAT

Full Affymetrix probeset data:

Annotations for 1627898_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720