Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627901_a_at:

>probe:Drosophila_2:1627901_a_at:489:183; Interrogation_Position=1016; Antisense; AAAATGTCCAGCTGCCAACCAATCG
>probe:Drosophila_2:1627901_a_at:134:89; Interrogation_Position=1088; Antisense; AGTCGGCCGCATTTTTGGCCCAGAA
>probe:Drosophila_2:1627901_a_at:556:601; Interrogation_Position=1121; Antisense; TGATACGCATGTGGCTGAACCCTAA
>probe:Drosophila_2:1627901_a_at:18:615; Interrogation_Position=1136; Antisense; TGAACCCTAATATGCTGATCTCCTA
>probe:Drosophila_2:1627901_a_at:107:453; Interrogation_Position=1152; Antisense; GATCTCCTAGGCAGCTCAATCAATT
>probe:Drosophila_2:1627901_a_at:202:57; Interrogation_Position=1254; Antisense; ATGAGCAATCTCTGTGGCACGTAGA
>probe:Drosophila_2:1627901_a_at:474:1; Interrogation_Position=1282; Antisense; ACGACCTAAACTATGGAAGCCCCTG
>probe:Drosophila_2:1627901_a_at:91:379; Interrogation_Position=1297; Antisense; GAAGCCCCTGGAGATTGAACTGTAT
>probe:Drosophila_2:1627901_a_at:5:109; Interrogation_Position=822; Antisense; AGAAGCTACTTCTCCGGAGCAGCCA
>probe:Drosophila_2:1627901_a_at:402:513; Interrogation_Position=872; Antisense; GTGATAATCAAAGTTCTCCGCCGAA
>probe:Drosophila_2:1627901_a_at:720:315; Interrogation_Position=913; Antisense; GCCTATCTGGACCATCACCATGAGA
>probe:Drosophila_2:1627901_a_at:261:233; Interrogation_Position=939; Antisense; AATGCAGCGCTTTCTGGCTGAGCAA
>probe:Drosophila_2:1627901_a_at:470:585; Interrogation_Position=969; Antisense; TGGTCAAAAGCCGTATCCCAACCGT
>probe:Drosophila_2:1627901_a_at:86:201; Interrogation_Position=988; Antisense; AACCGTGGCCAAGTGAAGACCTGCA

Paste this into a BLAST search page for me
AAAATGTCCAGCTGCCAACCAATCGAGTCGGCCGCATTTTTGGCCCAGAATGATACGCATGTGGCTGAACCCTAATGAACCCTAATATGCTGATCTCCTAGATCTCCTAGGCAGCTCAATCAATTATGAGCAATCTCTGTGGCACGTAGAACGACCTAAACTATGGAAGCCCCTGGAAGCCCCTGGAGATTGAACTGTATAGAAGCTACTTCTCCGGAGCAGCCAGTGATAATCAAAGTTCTCCGCCGAAGCCTATCTGGACCATCACCATGAGAAATGCAGCGCTTTCTGGCTGAGCAATGGTCAAAAGCCGTATCCCAACCGTAACCGTGGCCAAGTGAAGACCTGCA

Full Affymetrix probeset data:

Annotations for 1627901_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime