Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627903_at:

>probe:Drosophila_2:1627903_at:360:533; Interrogation_Position=152; Antisense; GGTGATGACTACTATGACGACTCTG
>probe:Drosophila_2:1627903_at:272:507; Interrogation_Position=201; Antisense; GTGTTGGTGCATCCAGTAGCTCAGA
>probe:Drosophila_2:1627903_at:402:99; Interrogation_Position=226; Antisense; AGATGATGCTAGTACCTCCGAGGAC
>probe:Drosophila_2:1627903_at:674:375; Interrogation_Position=263; Antisense; GAAGCTTCCGATACAGGTAGTTCTT
>probe:Drosophila_2:1627903_at:167:179; Interrogation_Position=291; Antisense; AAACTTCTGGAGATGGTTCCTCCGC
>probe:Drosophila_2:1627903_at:660:89; Interrogation_Position=329; Antisense; AGTTCAACTCCAACCAAGGCAGAAA
>probe:Drosophila_2:1627903_at:192:389; Interrogation_Position=361; Antisense; GAAAACTGCTGCACGCAGAGCTAGA
>probe:Drosophila_2:1627903_at:584:335; Interrogation_Position=407; Antisense; GCTGCTCCCAAACGCAAAGTAGCGG
>probe:Drosophila_2:1627903_at:401:125; Interrogation_Position=433; Antisense; AGCCGCGTCTGCCAAGAAGCAAACA
>probe:Drosophila_2:1627903_at:361:377; Interrogation_Position=448; Antisense; GAAGCAAACACCTGTTGCCCAAAAG
>probe:Drosophila_2:1627903_at:31:211; Interrogation_Position=470; Antisense; AAGAAGAAGACACCTGTGGCAGCCA
>probe:Drosophila_2:1627903_at:467:365; Interrogation_Position=505; Antisense; GAATACTGCCGCCAACAAACGCAAA
>probe:Drosophila_2:1627903_at:5:177; Interrogation_Position=527; Antisense; AAACGCACAGGCTAAGCAGTTCGAA
>probe:Drosophila_2:1627903_at:142:543; Interrogation_Position=556; Antisense; GGATAAATTCCCCATAGTCACTGAA

Paste this into a BLAST search page for me
GGTGATGACTACTATGACGACTCTGGTGTTGGTGCATCCAGTAGCTCAGAAGATGATGCTAGTACCTCCGAGGACGAAGCTTCCGATACAGGTAGTTCTTAAACTTCTGGAGATGGTTCCTCCGCAGTTCAACTCCAACCAAGGCAGAAAGAAAACTGCTGCACGCAGAGCTAGAGCTGCTCCCAAACGCAAAGTAGCGGAGCCGCGTCTGCCAAGAAGCAAACAGAAGCAAACACCTGTTGCCCAAAAGAAGAAGAAGACACCTGTGGCAGCCAGAATACTGCCGCCAACAAACGCAAAAAACGCACAGGCTAAGCAGTTCGAAGGATAAATTCCCCATAGTCACTGAA

Full Affymetrix probeset data:

Annotations for 1627903_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime