FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627904_at:

>probe:Drosophila_2:1627904_at:185:207; Interrogation_Position=304; Antisense; AAGCTTCTTCATTTCGTCAAGGTCA
>probe:Drosophila_2:1627904_at:165:437; Interrogation_Position=337; Antisense; GAGGAGGAGCCTGGGACCATCTTCA
>probe:Drosophila_2:1627904_at:112:113; Interrogation_Position=368; Antisense; AGCAGTTGCGGCTCGATTCGAACTA
>probe:Drosophila_2:1627904_at:46:189; Interrogation_Position=403; Antisense; AACAGCGATATATTCCGCCTGGAGT
>probe:Drosophila_2:1627904_at:126:285; Interrogation_Position=421; Antisense; CTGGAGTCCTTCTACAATTACCTGG
>probe:Drosophila_2:1627904_at:657:347; Interrogation_Position=449; Antisense; GCATGTACGTCAGCGGCAATTCCAA
>probe:Drosophila_2:1627904_at:570:727; Interrogation_Position=497; Antisense; TTGGCATCCACCGTTTGAACATCAA
>probe:Drosophila_2:1627904_at:233:365; Interrogation_Position=531; Antisense; GAATATCCATAAGTTCCATACGCCA
>probe:Drosophila_2:1627904_at:377:459; Interrogation_Position=622; Antisense; GATTTCACCACCGATTTTTCCGGAG
>probe:Drosophila_2:1627904_at:647:551; Interrogation_Position=643; Antisense; GGAGCACCCGGACATATCGCTATGT
>probe:Drosophila_2:1627904_at:655:603; Interrogation_Position=677; Antisense; TGTTGCTAGCAACTATCTTCCAGAT
>probe:Drosophila_2:1627904_at:294:645; Interrogation_Position=692; Antisense; TCTTCCAGATACAATTGCGGGTGCT
>probe:Drosophila_2:1627904_at:433:567; Interrogation_Position=736; Antisense; GGCAGTCAGAAGTTCCAGGCATTCG
>probe:Drosophila_2:1627904_at:283:113; Interrogation_Position=764; Antisense; AGCAGAACCTTACTGTTCACACGTT

Paste this into a BLAST search page for me
AAGCTTCTTCATTTCGTCAAGGTCAGAGGAGGAGCCTGGGACCATCTTCAAGCAGTTGCGGCTCGATTCGAACTAAACAGCGATATATTCCGCCTGGAGTCTGGAGTCCTTCTACAATTACCTGGGCATGTACGTCAGCGGCAATTCCAATTGGCATCCACCGTTTGAACATCAAGAATATCCATAAGTTCCATACGCCAGATTTCACCACCGATTTTTCCGGAGGGAGCACCCGGACATATCGCTATGTTGTTGCTAGCAACTATCTTCCAGATTCTTCCAGATACAATTGCGGGTGCTGGCAGTCAGAAGTTCCAGGCATTCGAGCAGAACCTTACTGTTCACACGTT

Full Affymetrix probeset data:

Annotations for 1627904_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720