Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627908_at:

>probe:Drosophila_2:1627908_at:266:101; Interrogation_Position=113; Antisense; AGAGTGACCTCTCGCTGGCATTCGA
>probe:Drosophila_2:1627908_at:205:357; Interrogation_Position=147; Antisense; GCAAATACCGGATGGCGGCTGCGAC
>probe:Drosophila_2:1627908_at:120:409; Interrogation_Position=232; Antisense; GACGATCTCGATCTGTCGGACATCG
>probe:Drosophila_2:1627908_at:311:439; Interrogation_Position=276; Antisense; GAGGCAGCATCTCCTTCCGGAAGAG
>probe:Drosophila_2:1627908_at:608:73; Interrogation_Position=299; Antisense; AGGAACCCCAGAACGATCCTCAGTA
>probe:Drosophila_2:1627908_at:445:265; Interrogation_Position=319; Antisense; CAGTACGTTGCCCTACACGAGATAA
>probe:Drosophila_2:1627908_at:671:427; Interrogation_Position=337; Antisense; GAGATAAACGCCCAGATCAGCCCGC
>probe:Drosophila_2:1627908_at:587:251; Interrogation_Position=381; Antisense; CAACAGCTTGGAGACGATCTTCGAG
>probe:Drosophila_2:1627908_at:415:37; Interrogation_Position=397; Antisense; ATCTTCGAGGGCGTTTTCCTGAGCA
>probe:Drosophila_2:1627908_at:488:455; Interrogation_Position=433; Antisense; GATAAAGCTTCCAGCTCGGGCAATT
>probe:Drosophila_2:1627908_at:143:329; Interrogation_Position=450; Antisense; GGGCAATTCCCGATTTACGCCCAAG
>probe:Drosophila_2:1627908_at:592:81; Interrogation_Position=47; Antisense; AGGGAGACCAGCTGAACGGCTCCTT
>probe:Drosophila_2:1627908_at:253:121; Interrogation_Position=473; Antisense; AGCGCGGACGTGCAAATCTCATCGA
>probe:Drosophila_2:1627908_at:285:337; Interrogation_Position=83; Antisense; GCTCGATGTCCTCCGTGGATATGGA

Paste this into a BLAST search page for me
AGAGTGACCTCTCGCTGGCATTCGAGCAAATACCGGATGGCGGCTGCGACGACGATCTCGATCTGTCGGACATCGGAGGCAGCATCTCCTTCCGGAAGAGAGGAACCCCAGAACGATCCTCAGTACAGTACGTTGCCCTACACGAGATAAGAGATAAACGCCCAGATCAGCCCGCCAACAGCTTGGAGACGATCTTCGAGATCTTCGAGGGCGTTTTCCTGAGCAGATAAAGCTTCCAGCTCGGGCAATTGGGCAATTCCCGATTTACGCCCAAGAGGGAGACCAGCTGAACGGCTCCTTAGCGCGGACGTGCAAATCTCATCGAGCTCGATGTCCTCCGTGGATATGGA

Full Affymetrix probeset data:

Annotations for 1627908_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime