FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627911_at:

>probe:Drosophila_2:1627911_at:574:127; Interrogation_Position=116; Antisense; ACCTTGTCACCCAGTTCGAAGTGGA
>probe:Drosophila_2:1627911_at:290:617; Interrogation_Position=164; Antisense; TGCAAACTGCTCTCGACAGCGGAAA
>probe:Drosophila_2:1627911_at:233:535; Interrogation_Position=231; Antisense; GGTACTAACCAGTTCAACAGCGCCG
>probe:Drosophila_2:1627911_at:365:513; Interrogation_Position=274; Antisense; GTGATGAAGCTAGCCCTGGGCGACT
>probe:Drosophila_2:1627911_at:529:109; Interrogation_Position=326; Antisense; AGAAGTTGCTACTAGCCTCCAGGCA
>probe:Drosophila_2:1627911_at:508:235; Interrogation_Position=35; Antisense; AATCGATTAATAAGCCACCGCCAAT
>probe:Drosophila_2:1627911_at:600:161; Interrogation_Position=350; Antisense; AAATCAAATTCACACCTACGGCTGA
>probe:Drosophila_2:1627911_at:151:287; Interrogation_Position=407; Antisense; CGGCGCTTCTGTCATCTGGAAAGGA
>probe:Drosophila_2:1627911_at:361:585; Interrogation_Position=423; Antisense; TGGAAAGGACTTCCGCTTCAACTTT
>probe:Drosophila_2:1627911_at:605:213; Interrogation_Position=476; Antisense; AAGAGCCTCAACCAGTCCAGGACTT
>probe:Drosophila_2:1627911_at:88:297; Interrogation_Position=529; Antisense; GCCGGAAGTCCGTTCAAGTTCAACT
>probe:Drosophila_2:1627911_at:419:45; Interrogation_Position=559; Antisense; ATCGCGGAGGATTCGGCCAATGACA
>probe:Drosophila_2:1627911_at:96:55; Interrogation_Position=578; Antisense; ATGACATTAGTTTCAGCGGTCTGAA
>probe:Drosophila_2:1627911_at:3:423; Interrogation_Position=65; Antisense; GAGCAATCAAGAAGCCCACGCCGGT

Paste this into a BLAST search page for me
ACCTTGTCACCCAGTTCGAAGTGGATGCAAACTGCTCTCGACAGCGGAAAGGTACTAACCAGTTCAACAGCGCCGGTGATGAAGCTAGCCCTGGGCGACTAGAAGTTGCTACTAGCCTCCAGGCAAATCGATTAATAAGCCACCGCCAATAAATCAAATTCACACCTACGGCTGACGGCGCTTCTGTCATCTGGAAAGGATGGAAAGGACTTCCGCTTCAACTTTAAGAGCCTCAACCAGTCCAGGACTTGCCGGAAGTCCGTTCAAGTTCAACTATCGCGGAGGATTCGGCCAATGACAATGACATTAGTTTCAGCGGTCTGAAGAGCAATCAAGAAGCCCACGCCGGT

Full Affymetrix probeset data:

Annotations for 1627911_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720