FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627912_at:

>probe:Drosophila_2:1627912_at:689:677; Interrogation_Position=1012; Antisense; TAGGGCCTAAGAAGATCCGGGAGCT
>probe:Drosophila_2:1627912_at:284:553; Interrogation_Position=1031; Antisense; GGAGCTGAGCTATCAAACATGGCGA
>probe:Drosophila_2:1627912_at:310:359; Interrogation_Position=1056; Antisense; GCAAGGGCCACGTTGGCGCTGATAA
>probe:Drosophila_2:1627912_at:655:509; Interrogation_Position=1075; Antisense; TGATAAGTTCCCATTCCAATCCATT
>probe:Drosophila_2:1627912_at:194:683; Interrogation_Position=1103; Antisense; TATCCCGGATCACAGCAGCGATTAG
>probe:Drosophila_2:1627912_at:393:423; Interrogation_Position=614; Antisense; GAGAAGCGCTACGAGTATCCCAATA
>probe:Drosophila_2:1627912_at:255:95; Interrogation_Position=638; Antisense; AGATCTGCCAGGGACAACGGCCGGT
>probe:Drosophila_2:1627912_at:664:527; Interrogation_Position=711; Antisense; GGGAGACACCAATCGCCGTCAATGA
>probe:Drosophila_2:1627912_at:433:299; Interrogation_Position=724; Antisense; CGCCGTCAATGATGTGGCCTACATA
>probe:Drosophila_2:1627912_at:620:55; Interrogation_Position=750; Antisense; ATGACAATCTGGGTCTGCATCGCGT
>probe:Drosophila_2:1627912_at:396:517; Interrogation_Position=773; Antisense; GTGGAGAACCCCAGCCATTCGGATA
>probe:Drosophila_2:1627912_at:378:619; Interrogation_Position=839; Antisense; TGCTCCGTGTTCCAGGACAACCTGA
>probe:Drosophila_2:1627912_at:594:535; Interrogation_Position=880; Antisense; GGTCACCTTCTGGAGCAAATACGGC
>probe:Drosophila_2:1627912_at:217:351; Interrogation_Position=916; Antisense; GCAGAACGAGCAGTAGATCCATCAA

Paste this into a BLAST search page for me
TAGGGCCTAAGAAGATCCGGGAGCTGGAGCTGAGCTATCAAACATGGCGAGCAAGGGCCACGTTGGCGCTGATAATGATAAGTTCCCATTCCAATCCATTTATCCCGGATCACAGCAGCGATTAGGAGAAGCGCTACGAGTATCCCAATAAGATCTGCCAGGGACAACGGCCGGTGGGAGACACCAATCGCCGTCAATGACGCCGTCAATGATGTGGCCTACATAATGACAATCTGGGTCTGCATCGCGTGTGGAGAACCCCAGCCATTCGGATATGCTCCGTGTTCCAGGACAACCTGAGGTCACCTTCTGGAGCAAATACGGCGCAGAACGAGCAGTAGATCCATCAA

Full Affymetrix probeset data:

Annotations for 1627912_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720