FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627917_at:

>probe:Drosophila_2:1627917_at:173:617; Interrogation_Position=125; Antisense; TGCACTGCCGCGTCCGGAATCTGGG
>probe:Drosophila_2:1627917_at:294:303; Interrogation_Position=132; Antisense; CCGCGTCCGGAATCTGGGCGATCGA
>probe:Drosophila_2:1627917_at:108:641; Interrogation_Position=144; Antisense; TCTGGGCGATCGAGCGGTAAGTGTT
>probe:Drosophila_2:1627917_at:91:537; Interrogation_Position=172; Antisense; GGTCAGGAACGGCTGCGGAGCAGCT
>probe:Drosophila_2:1627917_at:717:77; Interrogation_Position=26; Antisense; AGGTGCCGCCGCATTACTGGGAAAC
>probe:Drosophila_2:1627917_at:605:505; Interrogation_Position=28; Antisense; GTGCCGCCGCATTACTGGGAAACCC
>probe:Drosophila_2:1627917_at:104:339; Interrogation_Position=36; Antisense; GCATTACTGGGAAACCCCGTACTCG
>probe:Drosophila_2:1627917_at:269:593; Interrogation_Position=43; Antisense; TGGGAAACCCCGTACTCGCAGCCGT
>probe:Drosophila_2:1627917_at:310:667; Interrogation_Position=55; Antisense; TACTCGCAGCCGTACTTCGACAACT
>probe:Drosophila_2:1627917_at:420:489; Interrogation_Position=66; Antisense; GTACTTCGACAACTCCTCGAGGCGT
>probe:Drosophila_2:1627917_at:472:397; Interrogation_Position=73; Antisense; GACAACTCCTCGAGGCGTGAGGTCA
>probe:Drosophila_2:1627917_at:472:623; Interrogation_Position=79; Antisense; TCCTCGAGGCGTGAGGTCACCGCAA
>probe:Drosophila_2:1627917_at:447:71; Interrogation_Position=85; Antisense; AGGCGTGAGGTCACCGCAACCGTCG
>probe:Drosophila_2:1627917_at:122:435; Interrogation_Position=91; Antisense; GAGGTCACCGCAACCGTCGGCCAGG

Paste this into a BLAST search page for me
TGCACTGCCGCGTCCGGAATCTGGGCCGCGTCCGGAATCTGGGCGATCGATCTGGGCGATCGAGCGGTAAGTGTTGGTCAGGAACGGCTGCGGAGCAGCTAGGTGCCGCCGCATTACTGGGAAACGTGCCGCCGCATTACTGGGAAACCCGCATTACTGGGAAACCCCGTACTCGTGGGAAACCCCGTACTCGCAGCCGTTACTCGCAGCCGTACTTCGACAACTGTACTTCGACAACTCCTCGAGGCGTGACAACTCCTCGAGGCGTGAGGTCATCCTCGAGGCGTGAGGTCACCGCAAAGGCGTGAGGTCACCGCAACCGTCGGAGGTCACCGCAACCGTCGGCCAGG

Full Affymetrix probeset data:

Annotations for 1627917_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720