Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627918_at:

>probe:Drosophila_2:1627918_at:92:685; Interrogation_Position=1289; Antisense; TATCCGTGGACAGGGAATCGCTGCA
>probe:Drosophila_2:1627918_at:460:267; Interrogation_Position=1318; Antisense; CAGGGCGGCGACAGTATCAGTTCAC
>probe:Drosophila_2:1627918_at:209:641; Interrogation_Position=1344; Antisense; TCGGCCTGCCAGCATATTGACTGGA
>probe:Drosophila_2:1627918_at:496:5; Interrogation_Position=1359; Antisense; ATTGACTGGATCCATTTCCACATCC
>probe:Drosophila_2:1627918_at:714:693; Interrogation_Position=1373; Antisense; TTTCCACATCCGTTGGAGGCGGAGC
>probe:Drosophila_2:1627918_at:357:77; Interrogation_Position=1398; Antisense; AGGAGGATCACCGAAGCCCGAGAGT
>probe:Drosophila_2:1627918_at:555:43; Interrogation_Position=1452; Antisense; ATCGCAGCTGAGATCGGGATCCCAG
>probe:Drosophila_2:1627918_at:730:631; Interrogation_Position=1471; Antisense; TCCCAGCAGGGATCCATTGCCGAAT
>probe:Drosophila_2:1627918_at:151:643; Interrogation_Position=1507; Antisense; TCTCGCATCGGATCTCGCACAGGAT
>probe:Drosophila_2:1627918_at:124:629; Interrogation_Position=1580; Antisense; TCAAGTCCCAAACATCGATTCGCTC
>probe:Drosophila_2:1627918_at:628:461; Interrogation_Position=1596; Antisense; GATTCGCTCGCAAGGACAGGCAGGC
>probe:Drosophila_2:1627918_at:588:531; Interrogation_Position=1636; Antisense; GGGTCCATCAAGTCGGGATCGCAGC
>probe:Drosophila_2:1627918_at:267:451; Interrogation_Position=1652; Antisense; GATCGCAGCGTATGCAGAGTCCACA
>probe:Drosophila_2:1627918_at:724:549; Interrogation_Position=1849; Antisense; GGAGTTGCTGCCACCGTCAAGGAGC

Paste this into a BLAST search page for me
TATCCGTGGACAGGGAATCGCTGCACAGGGCGGCGACAGTATCAGTTCACTCGGCCTGCCAGCATATTGACTGGAATTGACTGGATCCATTTCCACATCCTTTCCACATCCGTTGGAGGCGGAGCAGGAGGATCACCGAAGCCCGAGAGTATCGCAGCTGAGATCGGGATCCCAGTCCCAGCAGGGATCCATTGCCGAATTCTCGCATCGGATCTCGCACAGGATTCAAGTCCCAAACATCGATTCGCTCGATTCGCTCGCAAGGACAGGCAGGCGGGTCCATCAAGTCGGGATCGCAGCGATCGCAGCGTATGCAGAGTCCACAGGAGTTGCTGCCACCGTCAAGGAGC

Full Affymetrix probeset data:

Annotations for 1627918_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime