Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627919_at:

>probe:Drosophila_2:1627919_at:715:367; Interrogation_Position=1145; Antisense; GAATGCCACCAAGATGCATCCGGAC
>probe:Drosophila_2:1627919_at:329:47; Interrogation_Position=1162; Antisense; ATCCGGACAACACATTCGGCTTGGC
>probe:Drosophila_2:1627919_at:157:303; Interrogation_Position=1187; Antisense; CCGCTGGCATGGCAACGACGATGAT
>probe:Drosophila_2:1627919_at:151:445; Interrogation_Position=1206; Antisense; GATGATGGCCAACTGCTGGACCTTA
>probe:Drosophila_2:1627919_at:711:585; Interrogation_Position=1222; Antisense; TGGACCTTATCGCTTTCCTAAAGAT
>probe:Drosophila_2:1627919_at:151:247; Interrogation_Position=1247; Antisense; AATTGCGCAGAACAACGTGGACGAC
>probe:Drosophila_2:1627919_at:714:125; Interrogation_Position=1318; Antisense; ACCAGTTCCGGGAGAACCAGCGCAA
>probe:Drosophila_2:1627919_at:72:383; Interrogation_Position=1368; Antisense; GAACGCATCGAGCAGTCCAAGACCA
>probe:Drosophila_2:1627919_at:346:537; Interrogation_Position=1400; Antisense; GGTCAAACAGTGGTCGCGCAACATT
>probe:Drosophila_2:1627919_at:127:681; Interrogation_Position=1434; Antisense; TAGGAGGCTGGCCATACCGCACAAC
>probe:Drosophila_2:1627919_at:280:157; Interrogation_Position=1523; Antisense; ACACTGGCCATATTTTTCGTCGACT
>probe:Drosophila_2:1627919_at:516:541; Interrogation_Position=1591; Antisense; GGATTGGGAGGCACGCTCTGTCTTT
>probe:Drosophila_2:1627919_at:573:641; Interrogation_Position=1607; Antisense; TCTGTCTTTTGCTCCTTTGGGAAAA
>probe:Drosophila_2:1627919_at:584:409; Interrogation_Position=1632; Antisense; GACGAGGCGCATGTTTTTGTTTTAT

Paste this into a BLAST search page for me
GAATGCCACCAAGATGCATCCGGACATCCGGACAACACATTCGGCTTGGCCCGCTGGCATGGCAACGACGATGATGATGATGGCCAACTGCTGGACCTTATGGACCTTATCGCTTTCCTAAAGATAATTGCGCAGAACAACGTGGACGACACCAGTTCCGGGAGAACCAGCGCAAGAACGCATCGAGCAGTCCAAGACCAGGTCAAACAGTGGTCGCGCAACATTTAGGAGGCTGGCCATACCGCACAACACACTGGCCATATTTTTCGTCGACTGGATTGGGAGGCACGCTCTGTCTTTTCTGTCTTTTGCTCCTTTGGGAAAAGACGAGGCGCATGTTTTTGTTTTAT

Full Affymetrix probeset data:

Annotations for 1627919_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime