Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627920_at:

>probe:Drosophila_2:1627920_at:98:301; Interrogation_Position=1350; Antisense; CGCCTGTCAGACCATGTTCATTTTG
>probe:Drosophila_2:1627920_at:613:59; Interrogation_Position=1363; Antisense; ATGTTCATTTTGGATGCCAGCCGGC
>probe:Drosophila_2:1627920_at:498:495; Interrogation_Position=1396; Antisense; GTCAGTCCGGAACATTTGCGCAAGA
>probe:Drosophila_2:1627920_at:629:133; Interrogation_Position=1428; Antisense; ACGCGAGATCGTCACATTTATGCTG
>probe:Drosophila_2:1627920_at:580:17; Interrogation_Position=1443; Antisense; ATTTATGCTGGTCGTCAATCTGGCC
>probe:Drosophila_2:1627920_at:636:63; Interrogation_Position=1468; Antisense; ATGTGGGCCATCAGTACGCTGGAGA
>probe:Drosophila_2:1627920_at:437:615; Interrogation_Position=1503; Antisense; TGAATCGCATCCCATACAGCTGAAC
>probe:Drosophila_2:1627920_at:231:385; Interrogation_Position=1524; Antisense; GAACTTCTACGGTTTGTGGGCCTGG
>probe:Drosophila_2:1627920_at:186:317; Interrogation_Position=1543; Antisense; GCCTGGACGATTATCACGCATGTGT
>probe:Drosophila_2:1627920_at:224:579; Interrogation_Position=1578; Antisense; GGCCATATTCTATCGTTTCCATTCG
>probe:Drosophila_2:1627920_at:382:695; Interrogation_Position=1593; Antisense; TTTCCATTCGACCAGCATTGCGCAG
>probe:Drosophila_2:1627920_at:363:545; Interrogation_Position=1635; Antisense; GGATCTCAAGACGAACCTGTCCTAC
>probe:Drosophila_2:1627920_at:534:351; Interrogation_Position=1847; Antisense; GCAGCTGTGGACTGAAGGCACCCAT
>probe:Drosophila_2:1627920_at:23:277; Interrogation_Position=1911; Antisense; CTTCTGTCCGGTTTACGTGATCAAC

Paste this into a BLAST search page for me
CGCCTGTCAGACCATGTTCATTTTGATGTTCATTTTGGATGCCAGCCGGCGTCAGTCCGGAACATTTGCGCAAGAACGCGAGATCGTCACATTTATGCTGATTTATGCTGGTCGTCAATCTGGCCATGTGGGCCATCAGTACGCTGGAGATGAATCGCATCCCATACAGCTGAACGAACTTCTACGGTTTGTGGGCCTGGGCCTGGACGATTATCACGCATGTGTGGCCATATTCTATCGTTTCCATTCGTTTCCATTCGACCAGCATTGCGCAGGGATCTCAAGACGAACCTGTCCTACGCAGCTGTGGACTGAAGGCACCCATCTTCTGTCCGGTTTACGTGATCAAC

Full Affymetrix probeset data:

Annotations for 1627920_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime