FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627922_at:

>probe:Drosophila_2:1627922_at:270:429; Interrogation_Position=130; Antisense; GAGTTCGAGCGCAAACGGCAGGCAC
>probe:Drosophila_2:1627922_at:310:143; Interrogation_Position=156; Antisense; ACTGGAGCACGAGTTGGCCGAGCAA
>probe:Drosophila_2:1627922_at:144:121; Interrogation_Position=242; Antisense; AGCTGGGCGAGCTCAATAGCATCCT
>probe:Drosophila_2:1627922_at:688:195; Interrogation_Position=303; Antisense; AACGGCATGTGGCAGTTTGACCAAC
>probe:Drosophila_2:1627922_at:456:281; Interrogation_Position=351; Antisense; CTCGGTGGATCTTTCGGCGGGCATT
>probe:Drosophila_2:1627922_at:431:291; Interrogation_Position=368; Antisense; CGGGCATTGGTAGATCGGGCTCAAT
>probe:Drosophila_2:1627922_at:288:549; Interrogation_Position=405; Antisense; GGAGGAGCGTCCTCCTGTCCAGGAA
>probe:Drosophila_2:1627922_at:422:123; Interrogation_Position=494; Antisense; AGCGCATGGACTCGCAGCTGGACAA
>probe:Drosophila_2:1627922_at:504:447; Interrogation_Position=523; Antisense; GATGCGCTGATCAACCAGGCGGACA
>probe:Drosophila_2:1627922_at:678:329; Interrogation_Position=541; Antisense; GCGGACAACGCTCAGATAGCCATGA
>probe:Drosophila_2:1627922_at:695:607; Interrogation_Position=567; Antisense; TGAGCAGACACAGCAGATGCGCCGC
>probe:Drosophila_2:1627922_at:131:303; Interrogation_Position=609; Antisense; CCCCTTGAGCAGGTGATCATCCATT
>probe:Drosophila_2:1627922_at:575:605; Interrogation_Position=622; Antisense; TGATCATCCATTGCTGACCCGCGAA
>probe:Drosophila_2:1627922_at:721:211; Interrogation_Position=654; Antisense; AAGAAACAGGCGTTTGCTTCATGAA

Paste this into a BLAST search page for me
GAGTTCGAGCGCAAACGGCAGGCACACTGGAGCACGAGTTGGCCGAGCAAAGCTGGGCGAGCTCAATAGCATCCTAACGGCATGTGGCAGTTTGACCAACCTCGGTGGATCTTTCGGCGGGCATTCGGGCATTGGTAGATCGGGCTCAATGGAGGAGCGTCCTCCTGTCCAGGAAAGCGCATGGACTCGCAGCTGGACAAGATGCGCTGATCAACCAGGCGGACAGCGGACAACGCTCAGATAGCCATGATGAGCAGACACAGCAGATGCGCCGCCCCCTTGAGCAGGTGATCATCCATTTGATCATCCATTGCTGACCCGCGAAAAGAAACAGGCGTTTGCTTCATGAA

Full Affymetrix probeset data:

Annotations for 1627922_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720