Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627923_at:

>probe:Drosophila_2:1627923_at:558:515; Interrogation_Position=3028; Antisense; GTGTACTCCAATTCGATCTCGCAAT
>probe:Drosophila_2:1627923_at:573:493; Interrogation_Position=3065; Antisense; GTCAGTCGTCGCAGAACGTGTGGAA
>probe:Drosophila_2:1627923_at:525:665; Interrogation_Position=3094; Antisense; TACAACTGCAACATCACCGGTGCGA
>probe:Drosophila_2:1627923_at:260:349; Interrogation_Position=3158; Antisense; GCAGGGTCAATGTCGGTGGTCACAA
>probe:Drosophila_2:1627923_at:251:503; Interrogation_Position=3219; Antisense; GTCGCAGGCATCCAATAGCTCTATG
>probe:Drosophila_2:1627923_at:367:681; Interrogation_Position=3240; Antisense; TATGGCCTCGTCGACGAACACATTG
>probe:Drosophila_2:1627923_at:90:203; Interrogation_Position=3310; Antisense; AACCAGGCCCAGTGTGGCAGAGTCT
>probe:Drosophila_2:1627923_at:497:431; Interrogation_Position=3329; Antisense; GAGTCTGCATCGGAATCGCCAGCGA
>probe:Drosophila_2:1627923_at:677:143; Interrogation_Position=3362; Antisense; ACTCCGCCGAGCAGAATGTATCCGA
>probe:Drosophila_2:1627923_at:543:59; Interrogation_Position=3377; Antisense; ATGTATCCGACGACGAGGTCACCGT
>probe:Drosophila_2:1627923_at:722:495; Interrogation_Position=3394; Antisense; GTCACCGTCCAAACTCCATTAATGA
>probe:Drosophila_2:1627923_at:728:453; Interrogation_Position=3417; Antisense; GATAAAGCGCGACAGCACCGTATGA
>probe:Drosophila_2:1627923_at:157:247; Interrogation_Position=3449; Antisense; AATTCCACAGGGTATTCGACACGCC
>probe:Drosophila_2:1627923_at:148:399; Interrogation_Position=3466; Antisense; GACACGCCCCTGTGATTAGGATTTA

Paste this into a BLAST search page for me
GTGTACTCCAATTCGATCTCGCAATGTCAGTCGTCGCAGAACGTGTGGAATACAACTGCAACATCACCGGTGCGAGCAGGGTCAATGTCGGTGGTCACAAGTCGCAGGCATCCAATAGCTCTATGTATGGCCTCGTCGACGAACACATTGAACCAGGCCCAGTGTGGCAGAGTCTGAGTCTGCATCGGAATCGCCAGCGAACTCCGCCGAGCAGAATGTATCCGAATGTATCCGACGACGAGGTCACCGTGTCACCGTCCAAACTCCATTAATGAGATAAAGCGCGACAGCACCGTATGAAATTCCACAGGGTATTCGACACGCCGACACGCCCCTGTGATTAGGATTTA

Full Affymetrix probeset data:

Annotations for 1627923_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime