Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627924_at:

>probe:Drosophila_2:1627924_at:158:433; Interrogation_Position=3067; Antisense; GAGTGGTGCATTACCAGCGTCTTCG
>probe:Drosophila_2:1627924_at:75:121; Interrogation_Position=3082; Antisense; AGCGTCTTCGGCACATGGTGTTTGA
>probe:Drosophila_2:1627924_at:661:121; Interrogation_Position=3131; Antisense; AGCGGTGGAAGCTCGGACCCATCAG
>probe:Drosophila_2:1627924_at:561:561; Interrogation_Position=3203; Antisense; GGAACGGGATGCTTTGATCTCTCAC
>probe:Drosophila_2:1627924_at:377:141; Interrogation_Position=3226; Antisense; ACGGTGCTGCTTTCCTGCTGCAGGA
>probe:Drosophila_2:1627924_at:144:725; Interrogation_Position=3255; Antisense; TTGTTCCACAACTCCGATAAGACGC
>probe:Drosophila_2:1627924_at:183:583; Interrogation_Position=3313; Antisense; TGGCGCCTCTGCAACGCATTGTTAA
>probe:Drosophila_2:1627924_at:369:549; Interrogation_Position=3351; Antisense; GGAGGACTCTCTTCTCAGCCAGATA
>probe:Drosophila_2:1627924_at:423:127; Interrogation_Position=3367; Antisense; AGCCAGATACGTGTCGCTTGTGCGG
>probe:Drosophila_2:1627924_at:49:663; Interrogation_Position=3395; Antisense; TAACAGTTCTGTATCGATGATCGAG
>probe:Drosophila_2:1627924_at:331:443; Interrogation_Position=3410; Antisense; GATGATCGAGATACCATTCTCTTTT
>probe:Drosophila_2:1627924_at:286:461; Interrogation_Position=3519; Antisense; GTTAGGTCCTATGTTAACCCGTGCG
>probe:Drosophila_2:1627924_at:479:657; Interrogation_Position=3532; Antisense; TTAACCCGTGCGCTAATCGTAATAA
>probe:Drosophila_2:1627924_at:456:509; Interrogation_Position=3580; Antisense; GTGCTTGCCAAGTGTTTATATCCAG

Paste this into a BLAST search page for me
GAGTGGTGCATTACCAGCGTCTTCGAGCGTCTTCGGCACATGGTGTTTGAAGCGGTGGAAGCTCGGACCCATCAGGGAACGGGATGCTTTGATCTCTCACACGGTGCTGCTTTCCTGCTGCAGGATTGTTCCACAACTCCGATAAGACGCTGGCGCCTCTGCAACGCATTGTTAAGGAGGACTCTCTTCTCAGCCAGATAAGCCAGATACGTGTCGCTTGTGCGGTAACAGTTCTGTATCGATGATCGAGGATGATCGAGATACCATTCTCTTTTGTTAGGTCCTATGTTAACCCGTGCGTTAACCCGTGCGCTAATCGTAATAAGTGCTTGCCAAGTGTTTATATCCAG

Full Affymetrix probeset data:

Annotations for 1627924_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime