FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627925_at:

>probe:Drosophila_2:1627925_at:595:515; Interrogation_Position=1036; Antisense; GTGTGCGGCTTCCTGATCGTTATCA
>probe:Drosophila_2:1627925_at:605:703; Interrogation_Position=1055; Antisense; TTATCACAGCTGTGTTCCTGCTCAA
>probe:Drosophila_2:1627925_at:716:59; Interrogation_Position=1112; Antisense; ATGTACGTGGACTGATGCGACCGAA
>probe:Drosophila_2:1627925_at:694:231; Interrogation_Position=1137; Antisense; AATGCAGCGGGTGTCGCAGTTCGAC
>probe:Drosophila_2:1627925_at:694:361; Interrogation_Position=1181; Antisense; GCAATACCAAGGAACGGCGGCTGTC
>probe:Drosophila_2:1627925_at:449:545; Interrogation_Position=1210; Antisense; GGATCCAGCGACATCTTCCGGAAGG
>probe:Drosophila_2:1627925_at:693:563; Interrogation_Position=1229; Antisense; GGAAGGCCTGACACAAGCAGCGCTA
>probe:Drosophila_2:1627925_at:268:113; Interrogation_Position=1244; Antisense; AGCAGCGCTACCAGGTCTAGTTACA
>probe:Drosophila_2:1627925_at:684:675; Interrogation_Position=1261; Antisense; TAGTTACATCCCTTGCAGCGGCTGA
>probe:Drosophila_2:1627925_at:448:367; Interrogation_Position=1289; Antisense; GAAGACAAGGTTGCTTTACTCCGTA
>probe:Drosophila_2:1627925_at:247:35; Interrogation_Position=1354; Antisense; ATCACTTTCATCTCATCATTTCCAT
>probe:Drosophila_2:1627925_at:12:471; Interrogation_Position=1384; Antisense; GTTCCTTCACTCTTGTTATTCATAC
>probe:Drosophila_2:1627925_at:266:489; Interrogation_Position=942; Antisense; GTACTATGTAATGTTCACCACCCTG
>probe:Drosophila_2:1627925_at:336:93; Interrogation_Position=998; Antisense; AGTTCACCCACATGCGGTTCGATGA

Paste this into a BLAST search page for me
GTGTGCGGCTTCCTGATCGTTATCATTATCACAGCTGTGTTCCTGCTCAAATGTACGTGGACTGATGCGACCGAAAATGCAGCGGGTGTCGCAGTTCGACGCAATACCAAGGAACGGCGGCTGTCGGATCCAGCGACATCTTCCGGAAGGGGAAGGCCTGACACAAGCAGCGCTAAGCAGCGCTACCAGGTCTAGTTACATAGTTACATCCCTTGCAGCGGCTGAGAAGACAAGGTTGCTTTACTCCGTAATCACTTTCATCTCATCATTTCCATGTTCCTTCACTCTTGTTATTCATACGTACTATGTAATGTTCACCACCCTGAGTTCACCCACATGCGGTTCGATGA

Full Affymetrix probeset data:

Annotations for 1627925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720