FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627926_at:

>probe:Drosophila_2:1627926_at:16:211; Interrogation_Position=355; Antisense; AAGCAAGCTGTCACAATCGCTGTTC
>probe:Drosophila_2:1627926_at:402:333; Interrogation_Position=441; Antisense; GCTGGTCCAACATCGCCAATAAGTA
>probe:Drosophila_2:1627926_at:200:33; Interrogation_Position=459; Antisense; ATAAGTACTGGCTCTTCTCGATCAT
>probe:Drosophila_2:1627926_at:462:191; Interrogation_Position=488; Antisense; AACTTGTGCCGGGACTTCTACGAGA
>probe:Drosophila_2:1627926_at:321:449; Interrogation_Position=511; Antisense; GATCCTGAGAGTACTGGACCTGCAT
>probe:Drosophila_2:1627926_at:340:413; Interrogation_Position=527; Antisense; GACCTGCATCGATCCGGTAGCAAGA
>probe:Drosophila_2:1627926_at:145:33; Interrogation_Position=584; Antisense; ATCAACTCGCCGGAGGACTTTAAGC
>probe:Drosophila_2:1627926_at:283:349; Interrogation_Position=619; Antisense; GCAGTCCTACGTGCTGATGCAGGGA
>probe:Drosophila_2:1627926_at:81:111; Interrogation_Position=672; Antisense; AGAATGCGTGCGACTTCTTCATTCC
>probe:Drosophila_2:1627926_at:694:141; Interrogation_Position=701; Antisense; ACGGCTCTGGGTTACACAAGTCTCA
>probe:Drosophila_2:1627926_at:30:527; Interrogation_Position=750; Antisense; GGGCAATTTCATCGCTGGCTGGACT
>probe:Drosophila_2:1627926_at:126:405; Interrogation_Position=771; Antisense; GACTCTGGGCTCTGCTGGAACCGAG
>probe:Drosophila_2:1627926_at:249:661; Interrogation_Position=804; Antisense; TAACGCCTGCATAACACCTGATATT
>probe:Drosophila_2:1627926_at:681:521; Interrogation_Position=846; Antisense; GGGCCTGTATTTCCTTGTATCTATT

Paste this into a BLAST search page for me
AAGCAAGCTGTCACAATCGCTGTTCGCTGGTCCAACATCGCCAATAAGTAATAAGTACTGGCTCTTCTCGATCATAACTTGTGCCGGGACTTCTACGAGAGATCCTGAGAGTACTGGACCTGCATGACCTGCATCGATCCGGTAGCAAGAATCAACTCGCCGGAGGACTTTAAGCGCAGTCCTACGTGCTGATGCAGGGAAGAATGCGTGCGACTTCTTCATTCCACGGCTCTGGGTTACACAAGTCTCAGGGCAATTTCATCGCTGGCTGGACTGACTCTGGGCTCTGCTGGAACCGAGTAACGCCTGCATAACACCTGATATTGGGCCTGTATTTCCTTGTATCTATT

Full Affymetrix probeset data:

Annotations for 1627926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720