FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627927_at:

>probe:Drosophila_2:1627927_at:203:725; Interrogation_Position=5306; Antisense; TTGATCGGGATCACCAGACACGTCC
>probe:Drosophila_2:1627927_at:150:399; Interrogation_Position=5322; Antisense; GACACGTCCGTCTGTCTAGAAACAC
>probe:Drosophila_2:1627927_at:181:439; Interrogation_Position=5374; Antisense; GAGGAATACTTGCTTCTTGTCACGC
>probe:Drosophila_2:1627927_at:19:275; Interrogation_Position=5386; Antisense; CTTCTTGTCACGCTTAGTTGTTTTA
>probe:Drosophila_2:1627927_at:682:161; Interrogation_Position=5479; Antisense; ACAATATTCGCCGTTATGCCAACAA
>probe:Drosophila_2:1627927_at:438:701; Interrogation_Position=5505; Antisense; TTTTAGAGATATCTTCCTGCCACCT
>probe:Drosophila_2:1627927_at:530:311; Interrogation_Position=5523; Antisense; GCCACCTCCCACTAGTTGAGTAACG
>probe:Drosophila_2:1627927_at:705:195; Interrogation_Position=5544; Antisense; AACGGGTATATGATAGTCGAGCAAA
>probe:Drosophila_2:1627927_at:70:165; Interrogation_Position=5566; Antisense; AAATCGACTATAGCGTTCTCTTGTT
>probe:Drosophila_2:1627927_at:236:123; Interrogation_Position=5577; Antisense; AGCGTTCTCTTGTTTTATGCATTGT
>probe:Drosophila_2:1627927_at:563:651; Interrogation_Position=5612; Antisense; TCAACTTTACAACGAGTGCGACTAA
>probe:Drosophila_2:1627927_at:390:1; Interrogation_Position=5646; Antisense; AATAACGTTAGGATTCACCCGATTG
>probe:Drosophila_2:1627927_at:530:53; Interrogation_Position=5767; Antisense; ATGCATACACATTTGGGTCCTTCGT
>probe:Drosophila_2:1627927_at:108:151; Interrogation_Position=5775; Antisense; ACATTTGGGTCCTTCGTCTATCAAG

Paste this into a BLAST search page for me
TTGATCGGGATCACCAGACACGTCCGACACGTCCGTCTGTCTAGAAACACGAGGAATACTTGCTTCTTGTCACGCCTTCTTGTCACGCTTAGTTGTTTTAACAATATTCGCCGTTATGCCAACAATTTTAGAGATATCTTCCTGCCACCTGCCACCTCCCACTAGTTGAGTAACGAACGGGTATATGATAGTCGAGCAAAAAATCGACTATAGCGTTCTCTTGTTAGCGTTCTCTTGTTTTATGCATTGTTCAACTTTACAACGAGTGCGACTAAAATAACGTTAGGATTCACCCGATTGATGCATACACATTTGGGTCCTTCGTACATTTGGGTCCTTCGTCTATCAAG

Full Affymetrix probeset data:

Annotations for 1627927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720