FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627928_at:

>probe:Drosophila_2:1627928_at:73:217; Interrogation_Position=1398; Antisense; AAGATTATCGTGTTGGCGCGGTCCA
>probe:Drosophila_2:1627928_at:259:615; Interrogation_Position=1437; Antisense; TGAAGAGCATCCTAACCTCATACCA
>probe:Drosophila_2:1627928_at:532:687; Interrogation_Position=1477; Antisense; TATTATCCGCACAATTAGCTCGATT
>probe:Drosophila_2:1627928_at:274:21; Interrogation_Position=1514; Antisense; ATATTTTTGTTCACCACTTGCGAGA
>probe:Drosophila_2:1627928_at:374:577; Interrogation_Position=1549; Antisense; GGCCCTTTCGCGTATTGAGATCTAT
>probe:Drosophila_2:1627928_at:101:445; Interrogation_Position=1610; Antisense; GATGATGCGGAAACCATTACCTGCA
>probe:Drosophila_2:1627928_at:716:505; Interrogation_Position=1650; Antisense; GTGCGCTTCATTTGCGCCGTAACAT
>probe:Drosophila_2:1627928_at:122:1; Interrogation_Position=1679; Antisense; CCGGTTCTTTACACCAAGGATCTCA
>probe:Drosophila_2:1627928_at:510:137; Interrogation_Position=1704; Antisense; ACGAGTGCAGCTACAGTCCGATTGA
>probe:Drosophila_2:1627928_at:263:423; Interrogation_Position=1773; Antisense; GAGACTTTGTAGTTACCCTGGAGGT
>probe:Drosophila_2:1627928_at:64:31; Interrogation_Position=1815; Antisense; ATAACGTGGTCATCGGCATAGGAGA
>probe:Drosophila_2:1627928_at:588:59; Interrogation_Position=1842; Antisense; ATGTTTGCATCCTGCGGGCATTTTA
>probe:Drosophila_2:1627928_at:107:299; Interrogation_Position=1875; Antisense; CGCTCTTTGCCTGCGAGAAGTTTAA
>probe:Drosophila_2:1627928_at:333:191; Interrogation_Position=1911; Antisense; AACTTTACGGCGTGCAGTTGTGCAG

Paste this into a BLAST search page for me
AAGATTATCGTGTTGGCGCGGTCCATGAAGAGCATCCTAACCTCATACCATATTATCCGCACAATTAGCTCGATTATATTTTTGTTCACCACTTGCGAGAGGCCCTTTCGCGTATTGAGATCTATGATGATGCGGAAACCATTACCTGCAGTGCGCTTCATTTGCGCCGTAACATCCGGTTCTTTACACCAAGGATCTCAACGAGTGCAGCTACAGTCCGATTGAGAGACTTTGTAGTTACCCTGGAGGTATAACGTGGTCATCGGCATAGGAGAATGTTTGCATCCTGCGGGCATTTTACGCTCTTTGCCTGCGAGAAGTTTAAAACTTTACGGCGTGCAGTTGTGCAG

Full Affymetrix probeset data:

Annotations for 1627928_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720