Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627930_s_at:

>probe:Drosophila_2:1627930_s_at:398:691; Interrogation_Position=580; Antisense; TTTGGATTCCACAGCGAAGGCAGAT
>probe:Drosophila_2:1627930_s_at:537:537; Interrogation_Position=617; Antisense; GGCTTCCCTTAATCTAACGCTAACT
>probe:Drosophila_2:1627930_s_at:516:661; Interrogation_Position=637; Antisense; TAACTCGCTAAATTGCTCCGCTGTT
>probe:Drosophila_2:1627930_s_at:114:333; Interrogation_Position=656; Antisense; GCTGTTTTACATTTTGGTTCGCCCA
>probe:Drosophila_2:1627930_s_at:543:539; Interrogation_Position=671; Antisense; GGTTCGCCCAATCCTTAATTGTTAT
>probe:Drosophila_2:1627930_s_at:397:681; Interrogation_Position=693; Antisense; TATGTGTATGTTTCTGCCACGCTAA
>probe:Drosophila_2:1627930_s_at:274:149; Interrogation_Position=735; Antisense; ACATTAAAATATCCAGCGCTTCGCG
>probe:Drosophila_2:1627930_s_at:350:343; Interrogation_Position=752; Antisense; GCTTCGCGGATAGGACAGCCACTAT
>probe:Drosophila_2:1627930_s_at:271:655; Interrogation_Position=788; Antisense; TAATGAATCCGCCTTTCTAGGTACC
>probe:Drosophila_2:1627930_s_at:579:313; Interrogation_Position=798; Antisense; GCCTTTCTAGGTACCCACATATGTA
>probe:Drosophila_2:1627930_s_at:380:491; Interrogation_Position=824; Antisense; GTACAAGCCTGATTACGAGCACAAA
>probe:Drosophila_2:1627930_s_at:480:219; Interrogation_Position=848; Antisense; AAGTCGCTTGTGTGTCCATTTTGAA
>probe:Drosophila_2:1627930_s_at:101:387; Interrogation_Position=873; Antisense; GAACAGGCCCTTTGATATTGCACAA
>probe:Drosophila_2:1627930_s_at:74:373; Interrogation_Position=912; Antisense; GAAGTCCGTCTTATGTTTTTCGCAC

Paste this into a BLAST search page for me
TTTGGATTCCACAGCGAAGGCAGATGGCTTCCCTTAATCTAACGCTAACTTAACTCGCTAAATTGCTCCGCTGTTGCTGTTTTACATTTTGGTTCGCCCAGGTTCGCCCAATCCTTAATTGTTATTATGTGTATGTTTCTGCCACGCTAAACATTAAAATATCCAGCGCTTCGCGGCTTCGCGGATAGGACAGCCACTATTAATGAATCCGCCTTTCTAGGTACCGCCTTTCTAGGTACCCACATATGTAGTACAAGCCTGATTACGAGCACAAAAAGTCGCTTGTGTGTCCATTTTGAAGAACAGGCCCTTTGATATTGCACAAGAAGTCCGTCTTATGTTTTTCGCAC

Full Affymetrix probeset data:

Annotations for 1627930_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime