FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627934_at:

>probe:Drosophila_2:1627934_at:533:363; Interrogation_Position=1172; Antisense; GAATTCCAGTTTTGCCACTCAGCTG
>probe:Drosophila_2:1627934_at:127:587; Interrogation_Position=1195; Antisense; TGGAGAAATCCCAGTACCATCTATC
>probe:Drosophila_2:1627934_at:347:91; Interrogation_Position=1207; Antisense; AGTACCATCTATCCAATTCCAGCTA
>probe:Drosophila_2:1627934_at:319:175; Interrogation_Position=1250; Antisense; AACACCAACTTCGTTTGACTATGTC
>probe:Drosophila_2:1627934_at:179:709; Interrogation_Position=1264; Antisense; TTGACTATGTCGACAGCTCCATGGT
>probe:Drosophila_2:1627934_at:45:119; Interrogation_Position=1278; Antisense; AGCTCCATGGTTGAGTGCGATGTCA
>probe:Drosophila_2:1627934_at:449:609; Interrogation_Position=1313; Antisense; TGAGCCTCTGCTATGAAGACTTCAT
>probe:Drosophila_2:1627934_at:253:551; Interrogation_Position=1379; Antisense; GGAGTATTCCTTTCATATTGTTACA
>probe:Drosophila_2:1627934_at:467:445; Interrogation_Position=1411; Antisense; GATGAAACCCTACTCATACATGAGT
>probe:Drosophila_2:1627934_at:584:31; Interrogation_Position=1459; Antisense; ATAAGACCATTATCCACACGCTGAA
>probe:Drosophila_2:1627934_at:431:49; Interrogation_Position=1470; Antisense; ATCCACACGCTGAATTGCTTGTAAA
>probe:Drosophila_2:1627934_at:286:655; Interrogation_Position=1521; Antisense; TAACCATTTTGACTCCGGGTATGCC
>probe:Drosophila_2:1627934_at:438:275; Interrogation_Position=1544; Antisense; CCATTCGCGGGCTGTTTTAAAGCAA
>probe:Drosophila_2:1627934_at:715:341; Interrogation_Position=1631; Antisense; GCTTATCATTGGGATGTCATCTGGA

Paste this into a BLAST search page for me
GAATTCCAGTTTTGCCACTCAGCTGTGGAGAAATCCCAGTACCATCTATCAGTACCATCTATCCAATTCCAGCTAAACACCAACTTCGTTTGACTATGTCTTGACTATGTCGACAGCTCCATGGTAGCTCCATGGTTGAGTGCGATGTCATGAGCCTCTGCTATGAAGACTTCATGGAGTATTCCTTTCATATTGTTACAGATGAAACCCTACTCATACATGAGTATAAGACCATTATCCACACGCTGAAATCCACACGCTGAATTGCTTGTAAATAACCATTTTGACTCCGGGTATGCCCCATTCGCGGGCTGTTTTAAAGCAAGCTTATCATTGGGATGTCATCTGGA

Full Affymetrix probeset data:

Annotations for 1627934_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720