Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627935_a_at:

>probe:Drosophila_2:1627935_a_at:212:289; Interrogation_Position=107; Antisense; CGGAGCTCAAGCGAACTGTGCGCAA
>probe:Drosophila_2:1627935_a_at:164:625; Interrogation_Position=125; Antisense; TGCGCAACTGTATGCATCGCCAGGA
>probe:Drosophila_2:1627935_a_at:690:725; Interrogation_Position=22; Antisense; TTGATTTTCCTGCTGATTTGTTTGA
>probe:Drosophila_2:1627935_a_at:454:639; Interrogation_Position=301; Antisense; TCGGATGGCAGGAACCACACCAGCA
>probe:Drosophila_2:1627935_a_at:640:79; Interrogation_Position=333; Antisense; AGGTCAGTGTGTGGCCCAGTGCTTT
>probe:Drosophila_2:1627935_a_at:464:301; Interrogation_Position=347; Antisense; CCCAGTGCTTTTTCGAGGAGATGAA
>probe:Drosophila_2:1627935_a_at:224:453; Interrogation_Position=36; Antisense; GATTTGTTTGAGCTGCGGCACCTGC
>probe:Drosophila_2:1627935_a_at:164:305; Interrogation_Position=395; Antisense; CCGATCGGCGCAAGGTGAGCTATTT
>probe:Drosophila_2:1627935_a_at:612:687; Interrogation_Position=415; Antisense; TATTTGCTGACCAAGGACCTTCGGG
>probe:Drosophila_2:1627935_a_at:292:419; Interrogation_Position=445; Antisense; GAGCTGCGCAACTTCTTCACGGACA
>probe:Drosophila_2:1627935_a_at:461:617; Interrogation_Position=473; Antisense; TGCAGCAGTGCTTCCGCTATCTGGA
>probe:Drosophila_2:1627935_a_at:628:285; Interrogation_Position=533; Antisense; CGGCCCGGGAACTGGTCAAGTGCAT
>probe:Drosophila_2:1627935_a_at:391:131; Interrogation_Position=55; Antisense; ACCTGCTCCATTTACGCACTGAAAT
>probe:Drosophila_2:1627935_a_at:715:351; Interrogation_Position=597; Antisense; GCACGGCAACATGCTCTTCAATTAG

Paste this into a BLAST search page for me
CGGAGCTCAAGCGAACTGTGCGCAATGCGCAACTGTATGCATCGCCAGGATTGATTTTCCTGCTGATTTGTTTGATCGGATGGCAGGAACCACACCAGCAAGGTCAGTGTGTGGCCCAGTGCTTTCCCAGTGCTTTTTCGAGGAGATGAAGATTTGTTTGAGCTGCGGCACCTGCCCGATCGGCGCAAGGTGAGCTATTTTATTTGCTGACCAAGGACCTTCGGGGAGCTGCGCAACTTCTTCACGGACATGCAGCAGTGCTTCCGCTATCTGGACGGCCCGGGAACTGGTCAAGTGCATACCTGCTCCATTTACGCACTGAAATGCACGGCAACATGCTCTTCAATTAG

Full Affymetrix probeset data:

Annotations for 1627935_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime