FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627937_at:

>probe:Drosophila_2:1627937_at:562:569; Interrogation_Position=125; Antisense; GGCATGCCGAGGTTCAAGATTTCAT
>probe:Drosophila_2:1627937_at:490:205; Interrogation_Position=163; Antisense; AAGCGTTTGGATTTCATCACATTAA
>probe:Drosophila_2:1627937_at:335:39; Interrogation_Position=257; Antisense; ATCTGATGCTAACCTGTCACTACGA
>probe:Drosophila_2:1627937_at:414:443; Interrogation_Position=310; Antisense; GATGAGTTCCTTGCAGCCGCAGAAG
>probe:Drosophila_2:1627937_at:547:109; Interrogation_Position=330; Antisense; AGAAGGCGCTGTATCGTGTGCCATT
>probe:Drosophila_2:1627937_at:247:507; Interrogation_Position=347; Antisense; GTGCCATTCTTCTTAACGTGGCCAA
>probe:Drosophila_2:1627937_at:534:503; Interrogation_Position=414; Antisense; GTCCGTGGGACTGGCTGTAATAACT
>probe:Drosophila_2:1627937_at:96:31; Interrogation_Position=433; Antisense; ATAACTCTCAGCTATATTGGCGCGC
>probe:Drosophila_2:1627937_at:704:725; Interrogation_Position=449; Antisense; TTGGCGCGCCAAATCAAACCTTTTT
>probe:Drosophila_2:1627937_at:62:461; Interrogation_Position=496; Antisense; GATTTGCACAACCTGATTGCTGACA
>probe:Drosophila_2:1627937_at:154:7; Interrogation_Position=511; Antisense; ATTGCTGACATCGAACAGGATCTCA
>probe:Drosophila_2:1627937_at:154:235; Interrogation_Position=539; Antisense; AATCCGGAGAACTCGACGACTGTCA
>probe:Drosophila_2:1627937_at:512:409; Interrogation_Position=553; Antisense; GACGACTGTCATGTGTTATTCCAAA
>probe:Drosophila_2:1627937_at:650:597; Interrogation_Position=694; Antisense; TGTGCCAGTCATTCATGTGAGTCCA

Paste this into a BLAST search page for me
GGCATGCCGAGGTTCAAGATTTCATAAGCGTTTGGATTTCATCACATTAAATCTGATGCTAACCTGTCACTACGAGATGAGTTCCTTGCAGCCGCAGAAGAGAAGGCGCTGTATCGTGTGCCATTGTGCCATTCTTCTTAACGTGGCCAAGTCCGTGGGACTGGCTGTAATAACTATAACTCTCAGCTATATTGGCGCGCTTGGCGCGCCAAATCAAACCTTTTTGATTTGCACAACCTGATTGCTGACAATTGCTGACATCGAACAGGATCTCAAATCCGGAGAACTCGACGACTGTCAGACGACTGTCATGTGTTATTCCAAATGTGCCAGTCATTCATGTGAGTCCA

Full Affymetrix probeset data:

Annotations for 1627937_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720