FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627938_at:

>probe:Drosophila_2:1627938_at:397:439; Interrogation_Position=2121; Antisense; GGGCAAAGTTCCACGGGTTCTATGA
>probe:Drosophila_2:1627938_at:13:295; Interrogation_Position=2168; Antisense; CGAAGGTGACGATAGCTCCAGTGAC
>probe:Drosophila_2:1627938_at:610:437; Interrogation_Position=2223; Antisense; GAGGCAAACCAGACGGAATCGACCG
>probe:Drosophila_2:1627938_at:29:155; Interrogation_Position=2271; Antisense; ACAGGACTGCCCTCGATGGAGGAAA
>probe:Drosophila_2:1627938_at:45:37; Interrogation_Position=2295; Antisense; ATCTATGGGTGCACCATCAATCCGC
>probe:Drosophila_2:1627938_at:175:321; Interrogation_Position=2318; Antisense; GCCCTCCAAGCAGAGCATGGCTGTT
>probe:Drosophila_2:1627938_at:178:489; Interrogation_Position=2351; Antisense; GTACGTGCAGATGGGCAAGCTGTCC
>probe:Drosophila_2:1627938_at:447:125; Interrogation_Position=2402; Antisense; AGCCGTTGCTCAGCGCGATCAGGAG
>probe:Drosophila_2:1627938_at:349:461; Interrogation_Position=2435; Antisense; GATTATGCGTGGCATTACCCTGCGT
>probe:Drosophila_2:1627938_at:190:283; Interrogation_Position=2454; Antisense; CTGCGTCCACTCAGTGACTACGGCA
>probe:Drosophila_2:1627938_at:117:501; Interrogation_Position=2508; Antisense; GTCGTTCCTCGCAAGAGTCTAACTA
>probe:Drosophila_2:1627938_at:365:685; Interrogation_Position=2531; Antisense; TATCTATGCCGAGTACTGTCGCACT
>probe:Drosophila_2:1627938_at:709:597; Interrogation_Position=2547; Antisense; TGTCGCACTCGAAGCACCTTTAATG
>probe:Drosophila_2:1627938_at:279:437; Interrogation_Position=2586; Antisense; GAGGAATTCGATGTACTCTATCAAT

Paste this into a BLAST search page for me
GGGCAAAGTTCCACGGGTTCTATGACGAAGGTGACGATAGCTCCAGTGACGAGGCAAACCAGACGGAATCGACCGACAGGACTGCCCTCGATGGAGGAAAATCTATGGGTGCACCATCAATCCGCGCCCTCCAAGCAGAGCATGGCTGTTGTACGTGCAGATGGGCAAGCTGTCCAGCCGTTGCTCAGCGCGATCAGGAGGATTATGCGTGGCATTACCCTGCGTCTGCGTCCACTCAGTGACTACGGCAGTCGTTCCTCGCAAGAGTCTAACTATATCTATGCCGAGTACTGTCGCACTTGTCGCACTCGAAGCACCTTTAATGGAGGAATTCGATGTACTCTATCAAT

Full Affymetrix probeset data:

Annotations for 1627938_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720