FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627941_at:

>probe:Drosophila_2:1627941_at:699:237; Interrogation_Position=136; Antisense; AATCTTAAGCTCTTCAGCACCGAGA
>probe:Drosophila_2:1627941_at:267:657; Interrogation_Position=186; Antisense; TAAGGAGCTCCAGGCCACAGGGAAA
>probe:Drosophila_2:1627941_at:610:543; Interrogation_Position=212; Antisense; GGATCAACCACTTGTACCAATGCCT
>probe:Drosophila_2:1627941_at:225:311; Interrogation_Position=250; Antisense; GCCACGATAGGCAACATTTTAAGGA
>probe:Drosophila_2:1627941_at:316:699; Interrogation_Position=266; Antisense; TTTTAAGGACCCTGACCGGTATCAG
>probe:Drosophila_2:1627941_at:246:483; Interrogation_Position=284; Antisense; GTATCAGGGACAACACTGCCAGGAT
>probe:Drosophila_2:1627941_at:674:143; Interrogation_Position=298; Antisense; ACTGCCAGGATGTTGAGCCGCTTGA
>probe:Drosophila_2:1627941_at:9:417; Interrogation_Position=312; Antisense; GAGCCGCTTGACCATATTCTTGGAC
>probe:Drosophila_2:1627941_at:125:409; Interrogation_Position=334; Antisense; GACGATGAAACACTGGCGAAGCACA
>probe:Drosophila_2:1627941_at:95:111; Interrogation_Position=358; Antisense; AGAATACGGCCCAAGCTCGAGAGTT
>probe:Drosophila_2:1627941_at:658:337; Interrogation_Position=372; Antisense; GCTCGAGAGTTCCAAGCTTCTGAAG
>probe:Drosophila_2:1627941_at:357:375; Interrogation_Position=393; Antisense; GAAGATGCTGCAGTTCCTAAGCCAC
>probe:Drosophila_2:1627941_at:661:659; Interrogation_Position=410; Antisense; TAAGCCACCGTTACGATACCGAATG
>probe:Drosophila_2:1627941_at:560:683; Interrogation_Position=93; Antisense; TATCCACAATGGTCAGGCGGTCATG

Paste this into a BLAST search page for me
AATCTTAAGCTCTTCAGCACCGAGATAAGGAGCTCCAGGCCACAGGGAAAGGATCAACCACTTGTACCAATGCCTGCCACGATAGGCAACATTTTAAGGATTTTAAGGACCCTGACCGGTATCAGGTATCAGGGACAACACTGCCAGGATACTGCCAGGATGTTGAGCCGCTTGAGAGCCGCTTGACCATATTCTTGGACGACGATGAAACACTGGCGAAGCACAAGAATACGGCCCAAGCTCGAGAGTTGCTCGAGAGTTCCAAGCTTCTGAAGGAAGATGCTGCAGTTCCTAAGCCACTAAGCCACCGTTACGATACCGAATGTATCCACAATGGTCAGGCGGTCATG

Full Affymetrix probeset data:

Annotations for 1627941_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720