FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627942_at:

>probe:Drosophila_2:1627942_at:84:533; Interrogation_Position=1020; Antisense; GGTGGTTCAAATAGATCCCGGCTTT
>probe:Drosophila_2:1627942_at:586:75; Interrogation_Position=1085; Antisense; AGGAGATCGTGTACCTGACCACCGA
>probe:Drosophila_2:1627942_at:96:437; Interrogation_Position=1120; Antisense; GAGGATATTTCCTACTTCATCGCGC
>probe:Drosophila_2:1627942_at:446:147; Interrogation_Position=1133; Antisense; ACTTCATCGCGCTGGACAATGCATA
>probe:Drosophila_2:1627942_at:315:127; Interrogation_Position=559; Antisense; AGCCAGGCGAACATCGAGGTCGTGC
>probe:Drosophila_2:1627942_at:471:637; Interrogation_Position=572; Antisense; TCGAGGTCGTGCAAAGCCAGCTGGA
>probe:Drosophila_2:1627942_at:464:29; Interrogation_Position=606; Antisense; ATACATACAGTATCTGCCCCAGGAG
>probe:Drosophila_2:1627942_at:400:555; Interrogation_Position=675; Antisense; GGACGAATACCTCGCCTACAAGAAG
>probe:Drosophila_2:1627942_at:35:551; Interrogation_Position=717; Antisense; GGAGTGCAAGCCCTGCGAATACAGA
>probe:Drosophila_2:1627942_at:101:383; Interrogation_Position=740; Antisense; GAACGGCCAGGAGATTCTGCTTCGT
>probe:Drosophila_2:1627942_at:667:11; Interrogation_Position=753; Antisense; ATTCTGCTTCGTTCGGCACATGCGA
>probe:Drosophila_2:1627942_at:497:621; Interrogation_Position=773; Antisense; TGCGATCGGCAAGGCATCTGGCCAA
>probe:Drosophila_2:1627942_at:489:641; Interrogation_Position=789; Antisense; TCTGGCCAAGATTCAAGCTGACCTT
>probe:Drosophila_2:1627942_at:477:205; Interrogation_Position=833; Antisense; AAGCTCTTGAGCCAGTAGAATACTT

Paste this into a BLAST search page for me
GGTGGTTCAAATAGATCCCGGCTTTAGGAGATCGTGTACCTGACCACCGAGAGGATATTTCCTACTTCATCGCGCACTTCATCGCGCTGGACAATGCATAAGCCAGGCGAACATCGAGGTCGTGCTCGAGGTCGTGCAAAGCCAGCTGGAATACATACAGTATCTGCCCCAGGAGGGACGAATACCTCGCCTACAAGAAGGGAGTGCAAGCCCTGCGAATACAGAGAACGGCCAGGAGATTCTGCTTCGTATTCTGCTTCGTTCGGCACATGCGATGCGATCGGCAAGGCATCTGGCCAATCTGGCCAAGATTCAAGCTGACCTTAAGCTCTTGAGCCAGTAGAATACTT

Full Affymetrix probeset data:

Annotations for 1627942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720