FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627943_at:

>probe:Drosophila_2:1627943_at:547:337; Interrogation_Position=144; Antisense; GCTCTGTGTGTATGGCTTCAACGCA
>probe:Drosophila_2:1627943_at:546:141; Interrogation_Position=182; Antisense; CTTTGGACCCCGTGAACTTCAATCA
>probe:Drosophila_2:1627943_at:677:449; Interrogation_Position=207; Antisense; GATCGATGGCTTCGAAGACCGTTCC
>probe:Drosophila_2:1627943_at:48:1; Interrogation_Position=222; Antisense; AGACCGTTCCCTGCTGGAAAGACTG
>probe:Drosophila_2:1627943_at:627:511; Interrogation_Position=251; Antisense; GTGATAGTTCGGTTCAGATGCTCAA
>probe:Drosophila_2:1627943_at:581:471; Interrogation_Position=262; Antisense; GTTCAGATGCTCAAGACTCGACGTC
>probe:Drosophila_2:1627943_at:635:405; Interrogation_Position=281; Antisense; GACGTCTTCGGGATGGAGTCTTCGA
>probe:Drosophila_2:1627943_at:382:429; Interrogation_Position=296; Antisense; GAGTCTTCGACGAGTGTTGCCTGAA
>probe:Drosophila_2:1627943_at:242:317; Interrogation_Position=314; Antisense; GCCTGAAGTCGTGCACCATGGATGA
>probe:Drosophila_2:1627943_at:214:81; Interrogation_Position=338; Antisense; AGGTGCTGAGATATTGTGCTGCCAA
>probe:Drosophila_2:1627943_at:353:729; Interrogation_Position=351; Antisense; TTGTGCTGCCAAGCCGAGAACAGTA
>probe:Drosophila_2:1627943_at:502:75; Interrogation_Position=40; Antisense; AGGAGGATCCTGCTACCTAGCCTAC
>probe:Drosophila_2:1627943_at:70:655; Interrogation_Position=71; Antisense; TAATCCTTATGATCGGCGGTGTCCA
>probe:Drosophila_2:1627943_at:509:261; Interrogation_Position=99; Antisense; CACCATGAAGTTGTGCGGCCGCAAA

Paste this into a BLAST search page for me
GCTCTGTGTGTATGGCTTCAACGCACTTTGGACCCCGTGAACTTCAATCAGATCGATGGCTTCGAAGACCGTTCCAGACCGTTCCCTGCTGGAAAGACTGGTGATAGTTCGGTTCAGATGCTCAAGTTCAGATGCTCAAGACTCGACGTCGACGTCTTCGGGATGGAGTCTTCGAGAGTCTTCGACGAGTGTTGCCTGAAGCCTGAAGTCGTGCACCATGGATGAAGGTGCTGAGATATTGTGCTGCCAATTGTGCTGCCAAGCCGAGAACAGTAAGGAGGATCCTGCTACCTAGCCTACTAATCCTTATGATCGGCGGTGTCCACACCATGAAGTTGTGCGGCCGCAAA

Full Affymetrix probeset data:

Annotations for 1627943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720