Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627944_a_at:

>probe:Drosophila_2:1627944_a_at:58:75; Interrogation_Position=1023; Antisense; AGGAGCGCTCCAAGTTGGCGACCAT
>probe:Drosophila_2:1627944_a_at:344:575; Interrogation_Position=1039; Antisense; GGCGACCATGCTGCGAGATTTTCAA
>probe:Drosophila_2:1627944_a_at:495:107; Interrogation_Position=1071; Antisense; AGAAGGAACTTCTCTCCCAGGCTGA
>probe:Drosophila_2:1627944_a_at:165:359; Interrogation_Position=737; Antisense; GAAGTAGTTTCTGTGGAACCCGAGA
>probe:Drosophila_2:1627944_a_at:651:149; Interrogation_Position=780; Antisense; ACTTGCCTTTGGGAGAGCCACCGGA
>probe:Drosophila_2:1627944_a_at:716:303; Interrogation_Position=807; Antisense; CCGAGGAGCTCATCAGGGCCCTGAC
>probe:Drosophila_2:1627944_a_at:718:79; Interrogation_Position=821; Antisense; AGGGCCCTGACCAGCATCGAAAACT
>probe:Drosophila_2:1627944_a_at:154:389; Interrogation_Position=839; Antisense; GAAAACTCCGCATCCAGCGATGCTG
>probe:Drosophila_2:1627944_a_at:64:295; Interrogation_Position=856; Antisense; CGATGCTGTGGTGCGCGAACGTATC
>probe:Drosophila_2:1627944_a_at:662:207; Interrogation_Position=884; Antisense; AAGCTGCCCCAGGAAATATCCGAGA
>probe:Drosophila_2:1627944_a_at:459:23; Interrogation_Position=899; Antisense; ATATCCGAGATTAGCTGCATCAGCA
>probe:Drosophila_2:1627944_a_at:710:561; Interrogation_Position=949; Antisense; GGAACTGGCCATACAGGTGAACGAA
>probe:Drosophila_2:1627944_a_at:691:333; Interrogation_Position=974; Antisense; GCTGTGGATCTGCTGAACGACTACA
>probe:Drosophila_2:1627944_a_at:546:135; Interrogation_Position=990; Antisense; ACGACTACAATGCTCGGTTGGCGGC

Paste this into a BLAST search page for me
AGGAGCGCTCCAAGTTGGCGACCATGGCGACCATGCTGCGAGATTTTCAAAGAAGGAACTTCTCTCCCAGGCTGAGAAGTAGTTTCTGTGGAACCCGAGAACTTGCCTTTGGGAGAGCCACCGGACCGAGGAGCTCATCAGGGCCCTGACAGGGCCCTGACCAGCATCGAAAACTGAAAACTCCGCATCCAGCGATGCTGCGATGCTGTGGTGCGCGAACGTATCAAGCTGCCCCAGGAAATATCCGAGAATATCCGAGATTAGCTGCATCAGCAGGAACTGGCCATACAGGTGAACGAAGCTGTGGATCTGCTGAACGACTACAACGACTACAATGCTCGGTTGGCGGC

Full Affymetrix probeset data:

Annotations for 1627944_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime