FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627945_at:

>probe:Drosophila_2:1627945_at:267:583; Interrogation_Position=157; Antisense; TGGCGAGTTCGAATGGCAGGATCCC
>probe:Drosophila_2:1627945_at:706:439; Interrogation_Position=224; Antisense; GATGGAAAGCGCACCAAGGTCCAGG
>probe:Drosophila_2:1627945_at:493:323; Interrogation_Position=258; Antisense; GCGACAATGTTCTGTACTTGGCCCA
>probe:Drosophila_2:1627945_at:720:599; Interrogation_Position=270; Antisense; TGTACTTGGCCCATCGCCATGGAAT
>probe:Drosophila_2:1627945_at:345:489; Interrogation_Position=346; Antisense; GTACGTCCAGCATGATTACCTGCAG
>probe:Drosophila_2:1627945_at:437:75; Interrogation_Position=396; Antisense; AGGACGACCTGCTGGATATGGCGCC
>probe:Drosophila_2:1627945_at:444:25; Interrogation_Position=411; Antisense; ATATGGCGCCATTTCTGCGCGAGAA
>probe:Drosophila_2:1627945_at:51:423; Interrogation_Position=431; Antisense; GAGAACTCCCGGCTCGGCTGTCAGA
>probe:Drosophila_2:1627945_at:446:573; Interrogation_Position=446; Antisense; GGCTGTCAGATACTCCTCGACAAGA
>probe:Drosophila_2:1627945_at:251:561; Interrogation_Position=510; Antisense; GGAACTTCTACGTCGATGGGCACAA
>probe:Drosophila_2:1627945_at:684:249; Interrogation_Position=532; Antisense; CAAGCCCAAGCCACATTAACATTAT
>probe:Drosophila_2:1627945_at:422:151; Interrogation_Position=550; Antisense; ACATTATTGTTATATCCCGCATTAT
>probe:Drosophila_2:1627945_at:592:135; Interrogation_Position=587; Antisense; ACGACTGTTGAATTACCATTTGGTT
>probe:Drosophila_2:1627945_at:419:231; Interrogation_Position=647; Antisense; AATGCTTCGGTTTTGTGTTGTTCCA

Paste this into a BLAST search page for me
TGGCGAGTTCGAATGGCAGGATCCCGATGGAAAGCGCACCAAGGTCCAGGGCGACAATGTTCTGTACTTGGCCCATGTACTTGGCCCATCGCCATGGAATGTACGTCCAGCATGATTACCTGCAGAGGACGACCTGCTGGATATGGCGCCATATGGCGCCATTTCTGCGCGAGAAGAGAACTCCCGGCTCGGCTGTCAGAGGCTGTCAGATACTCCTCGACAAGAGGAACTTCTACGTCGATGGGCACAACAAGCCCAAGCCACATTAACATTATACATTATTGTTATATCCCGCATTATACGACTGTTGAATTACCATTTGGTTAATGCTTCGGTTTTGTGTTGTTCCA

Full Affymetrix probeset data:

Annotations for 1627945_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720