FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627946_at:

>probe:Drosophila_2:1627946_at:381:97; Interrogation_Position=431; Antisense; AGATCAACTGCAACCTGCTGGGCAC
>probe:Drosophila_2:1627946_at:169:623; Interrogation_Position=446; Antisense; TGCTGGGCACCATGAGGCTGACACA
>probe:Drosophila_2:1627946_at:376:229; Interrogation_Position=514; Antisense; AATGTGACCAGCCACTGCGGATTGC
>probe:Drosophila_2:1627946_at:323:435; Interrogation_Position=634; Antisense; GAGGTGGTCAACTTCATACCAGGCT
>probe:Drosophila_2:1627946_at:567:717; Interrogation_Position=661; Antisense; TTCGTCCTGGACAGCAACATTGCGG
>probe:Drosophila_2:1627946_at:90:325; Interrogation_Position=716; Antisense; GCGAAGCCTTCAGTGCGGAGCAACA
>probe:Drosophila_2:1627946_at:542:187; Interrogation_Position=737; Antisense; AACACGCTCTGTACGACACTTACTT
>probe:Drosophila_2:1627946_at:159:133; Interrogation_Position=752; Antisense; ACACTTACTTCGAGGCCTTCAATGG
>probe:Drosophila_2:1627946_at:721:381; Interrogation_Position=822; Antisense; GAACGAGTCGCTGCTGGCAAAGTTT
>probe:Drosophila_2:1627946_at:650:223; Interrogation_Position=847; Antisense; AAGGATGCATTGACCAGCTCACAAC
>probe:Drosophila_2:1627946_at:666:157; Interrogation_Position=867; Antisense; ACAACCCTTGGCTCTGTACATCGAG
>probe:Drosophila_2:1627946_at:617:487; Interrogation_Position=882; Antisense; GTACATCGAGGAACCCCGTAGATAT
>probe:Drosophila_2:1627946_at:669:485; Interrogation_Position=899; Antisense; GTAGATATCGCCTCTATCGCTGGCT
>probe:Drosophila_2:1627946_at:147:145; Interrogation_Position=940; Antisense; ACTCCGCTAGTGGATTGGCTCACGG

Paste this into a BLAST search page for me
AGATCAACTGCAACCTGCTGGGCACTGCTGGGCACCATGAGGCTGACACAAATGTGACCAGCCACTGCGGATTGCGAGGTGGTCAACTTCATACCAGGCTTTCGTCCTGGACAGCAACATTGCGGGCGAAGCCTTCAGTGCGGAGCAACAAACACGCTCTGTACGACACTTACTTACACTTACTTCGAGGCCTTCAATGGGAACGAGTCGCTGCTGGCAAAGTTTAAGGATGCATTGACCAGCTCACAACACAACCCTTGGCTCTGTACATCGAGGTACATCGAGGAACCCCGTAGATATGTAGATATCGCCTCTATCGCTGGCTACTCCGCTAGTGGATTGGCTCACGG

Full Affymetrix probeset data:

Annotations for 1627946_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720