Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627948_at:

>probe:Drosophila_2:1627948_at:375:243; Interrogation_Position=2676; Antisense; AATATCATTGTGTTGCGAAGGTAAA
>probe:Drosophila_2:1627948_at:376:205; Interrogation_Position=2793; Antisense; AAGCGCATATTGTTAAATTTCCAAA
>probe:Drosophila_2:1627948_at:721:685; Interrogation_Position=2810; Antisense; TTTCCAAATACAACGCAATCTAAGA
>probe:Drosophila_2:1627948_at:477:161; Interrogation_Position=2924; Antisense; CAAATTGCACTTAAACGTTACCGAT
>probe:Drosophila_2:1627948_at:157:203; Interrogation_Position=2961; Antisense; AACCAATATTCTTTAGCCTATCCCA
>probe:Drosophila_2:1627948_at:611:315; Interrogation_Position=2976; Antisense; GCCTATCCCAATTATTATGTTGTTG
>probe:Drosophila_2:1627948_at:690:465; Interrogation_Position=2997; Antisense; GTTGTGTTTGATAACCAAGTTCTAT
>probe:Drosophila_2:1627948_at:266:707; Interrogation_Position=3050; Antisense; TTACTGAGCGTATAACATCAATTTG
>probe:Drosophila_2:1627948_at:424:247; Interrogation_Position=3068; Antisense; CAATTTGTATCTTCTTCAACTGATG
>probe:Drosophila_2:1627948_at:220:651; Interrogation_Position=3083; Antisense; TCAACTGATGTTTCCGACTAATTTT
>probe:Drosophila_2:1627948_at:725:291; Interrogation_Position=3097; Antisense; CGACTAATTTTTTAAACTGGATGCA
>probe:Drosophila_2:1627948_at:51:143; Interrogation_Position=3112; Antisense; ACTGGATGCACTTTTGGCATATACT
>probe:Drosophila_2:1627948_at:516:569; Interrogation_Position=3127; Antisense; GGCATATACTACCAGATGCTAGCAA
>probe:Drosophila_2:1627948_at:361:457; Interrogation_Position=3173; Antisense; GATAGTTGCGTTACAATTATGCATA

Paste this into a BLAST search page for me
AATATCATTGTGTTGCGAAGGTAAAAAGCGCATATTGTTAAATTTCCAAATTTCCAAATACAACGCAATCTAAGACAAATTGCACTTAAACGTTACCGATAACCAATATTCTTTAGCCTATCCCAGCCTATCCCAATTATTATGTTGTTGGTTGTGTTTGATAACCAAGTTCTATTTACTGAGCGTATAACATCAATTTGCAATTTGTATCTTCTTCAACTGATGTCAACTGATGTTTCCGACTAATTTTCGACTAATTTTTTAAACTGGATGCAACTGGATGCACTTTTGGCATATACTGGCATATACTACCAGATGCTAGCAAGATAGTTGCGTTACAATTATGCATA

Full Affymetrix probeset data:

Annotations for 1627948_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime