FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627950_at:

>probe:Drosophila_2:1627950_at:149:515; Interrogation_Position=114; Antisense; GTGTCATCCGCAGGACCAATACATG
>probe:Drosophila_2:1627950_at:528:241; Interrogation_Position=131; Antisense; AATACATGTCATCCGCAGGCAGCGG
>probe:Drosophila_2:1627950_at:723:697; Interrogation_Position=162; Antisense; TTTAGCCCAGGCAAATACGGAGTCG
>probe:Drosophila_2:1627950_at:302:431; Interrogation_Position=181; Antisense; GAGTCGACCTCCGAAGTGGTAGTTC
>probe:Drosophila_2:1627950_at:330:83; Interrogation_Position=195; Antisense; AGTGGTAGTTCATCCGAGCAACGGC
>probe:Drosophila_2:1627950_at:596:105; Interrogation_Position=239; Antisense; AGACAGGACAACTGGCACTCCGAAT
>probe:Drosophila_2:1627950_at:626:279; Interrogation_Position=256; Antisense; CTCCGAATCCTAGCGATAAGCCTAT
>probe:Drosophila_2:1627950_at:248:577; Interrogation_Position=26; Antisense; GGCGCATCCTCGACTTATATAGCAA
>probe:Drosophila_2:1627950_at:387:223; Interrogation_Position=421; Antisense; AAGGTCCATCGCAAGCGGTTCAGGA
>probe:Drosophila_2:1627950_at:144:381; Interrogation_Position=450; Antisense; GAACCTCAAGTACTCGATTAAGCGC
>probe:Drosophila_2:1627950_at:586:287; Interrogation_Position=52; Antisense; CTGGACTGGATAACCCACTGCGGGA
>probe:Drosophila_2:1627950_at:498:187; Interrogation_Position=520; Antisense; AACAGGACCAGGAATCGCTCCGGAA
>probe:Drosophila_2:1627950_at:312:497; Interrogation_Position=550; Antisense; GTCAGTGTGCGCAGCCTCAATAGGC
>probe:Drosophila_2:1627950_at:440:101; Interrogation_Position=99; Antisense; AGAGCGTCAGTATCGGTGTCATCCG

Paste this into a BLAST search page for me
GTGTCATCCGCAGGACCAATACATGAATACATGTCATCCGCAGGCAGCGGTTTAGCCCAGGCAAATACGGAGTCGGAGTCGACCTCCGAAGTGGTAGTTCAGTGGTAGTTCATCCGAGCAACGGCAGACAGGACAACTGGCACTCCGAATCTCCGAATCCTAGCGATAAGCCTATGGCGCATCCTCGACTTATATAGCAAAAGGTCCATCGCAAGCGGTTCAGGAGAACCTCAAGTACTCGATTAAGCGCCTGGACTGGATAACCCACTGCGGGAAACAGGACCAGGAATCGCTCCGGAAGTCAGTGTGCGCAGCCTCAATAGGCAGAGCGTCAGTATCGGTGTCATCCG

Full Affymetrix probeset data:

Annotations for 1627950_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720