FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627951_at:

>probe:Drosophila_2:1627951_at:359:367; Interrogation_Position=1002; Antisense; GAATCGGGCAGAGTCCCAGATCTTC
>probe:Drosophila_2:1627951_at:81:97; Interrogation_Position=1019; Antisense; AGATCTTCGACCTACAGAGCTCTCA
>probe:Drosophila_2:1627951_at:197:225; Interrogation_Position=1048; Antisense; AAGGAGTTTTGCCTGACCAGCTGCC
>probe:Drosophila_2:1627951_at:316:413; Interrogation_Position=1075; Antisense; GACCTAATTTTCTTTCCCGATGCAT
>probe:Drosophila_2:1627951_at:17:701; Interrogation_Position=1099; Antisense; TTTTCCACTCCATTCAGCCAAAAGG
>probe:Drosophila_2:1627951_at:412:567; Interrogation_Position=1131; Antisense; GGCACAGACCAACTACTTGACGAAT
>probe:Drosophila_2:1627951_at:164:717; Interrogation_Position=1239; Antisense; TTCGTATACCGGACCCACTGAATAT
>probe:Drosophila_2:1627951_at:329:3; Interrogation_Position=742; Antisense; ATTGGGCACCAGACGAGTTTTCGCA
>probe:Drosophila_2:1627951_at:571:389; Interrogation_Position=776; Antisense; GAAACGTTGAGGCTACACCCTCTAT
>probe:Drosophila_2:1627951_at:20:15; Interrogation_Position=852; Antisense; ATTACTCTTCTATCGCTACTATACG
>probe:Drosophila_2:1627951_at:15:509; Interrogation_Position=897; Antisense; GTGCGACTCCATGTTTTTCCTGAGA
>probe:Drosophila_2:1627951_at:535:403; Interrogation_Position=920; Antisense; GACTTTGCAGTTGTATTCCCTACTA
>probe:Drosophila_2:1627951_at:229:655; Interrogation_Position=953; Antisense; TAATTTATCCCAACGCCTCAGTGTG
>probe:Drosophila_2:1627951_at:97:517; Interrogation_Position=973; Antisense; GTGTGCGATGTGTTCCACTTTGAAT

Paste this into a BLAST search page for me
GAATCGGGCAGAGTCCCAGATCTTCAGATCTTCGACCTACAGAGCTCTCAAAGGAGTTTTGCCTGACCAGCTGCCGACCTAATTTTCTTTCCCGATGCATTTTTCCACTCCATTCAGCCAAAAGGGGCACAGACCAACTACTTGACGAATTTCGTATACCGGACCCACTGAATATATTGGGCACCAGACGAGTTTTCGCAGAAACGTTGAGGCTACACCCTCTATATTACTCTTCTATCGCTACTATACGGTGCGACTCCATGTTTTTCCTGAGAGACTTTGCAGTTGTATTCCCTACTATAATTTATCCCAACGCCTCAGTGTGGTGTGCGATGTGTTCCACTTTGAAT

Full Affymetrix probeset data:

Annotations for 1627951_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720