FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627953_at:

>probe:Drosophila_2:1627953_at:524:269; Interrogation_Position=1395; Antisense; CATGAAGGGCGCCATCAAGCACAGC
>probe:Drosophila_2:1627953_at:643:255; Interrogation_Position=1414; Antisense; CACAGCCTACTCACTTTTATTCGGG
>probe:Drosophila_2:1627953_at:494:333; Interrogation_Position=1448; Antisense; GCTGCAAACTGCTGGCCTTTAATGG
>probe:Drosophila_2:1627953_at:2:391; Interrogation_Position=1487; Antisense; GAAACCGTCGCAGTAACCTGAAGAC
>probe:Drosophila_2:1627953_at:617:375; Interrogation_Position=1506; Antisense; GAAGACCTACTGGATATGCTCCAAA
>probe:Drosophila_2:1627953_at:258:389; Interrogation_Position=1542; Antisense; GAAATGCAATGCTCGGGTGGTCACC
>probe:Drosophila_2:1627953_at:662:89; Interrogation_Position=1593; Antisense; AGTACTGGAATCGTGCCATCACACC
>probe:Drosophila_2:1627953_at:82:261; Interrogation_Position=1614; Antisense; CACCTGCCTGAACACGGAGCGAAAA
>probe:Drosophila_2:1627953_at:699:79; Interrogation_Position=1640; Antisense; AGCGGCTTTCAGTAACAAACGTTGT
>probe:Drosophila_2:1627953_at:16:389; Interrogation_Position=1687; Antisense; GAAAAGTCTGTATCCACGGGCTTCA
>probe:Drosophila_2:1627953_at:135:409; Interrogation_Position=1726; Antisense; GACGAGGATTTAACACTGGAGCTAA
>probe:Drosophila_2:1627953_at:367:225; Interrogation_Position=1749; Antisense; AAGGACGCTCAACTTAAGCATCGAG
>probe:Drosophila_2:1627953_at:494:437; Interrogation_Position=1771; Antisense; GAGGACCTTAACAACCTGCAATGAA
>probe:Drosophila_2:1627953_at:416:165; Interrogation_Position=1806; Antisense; AAATCTAGCCATAGCTTGCGAACTA

Paste this into a BLAST search page for me
CATGAAGGGCGCCATCAAGCACAGCCACAGCCTACTCACTTTTATTCGGGGCTGCAAACTGCTGGCCTTTAATGGGAAACCGTCGCAGTAACCTGAAGACGAAGACCTACTGGATATGCTCCAAAGAAATGCAATGCTCGGGTGGTCACCAGTACTGGAATCGTGCCATCACACCCACCTGCCTGAACACGGAGCGAAAAAGCGGCTTTCAGTAACAAACGTTGTGAAAAGTCTGTATCCACGGGCTTCAGACGAGGATTTAACACTGGAGCTAAAAGGACGCTCAACTTAAGCATCGAGGAGGACCTTAACAACCTGCAATGAAAAATCTAGCCATAGCTTGCGAACTA

Full Affymetrix probeset data:

Annotations for 1627953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720