Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627954_a_at:

>probe:Drosophila_2:1627954_a_at:79:279; Interrogation_Position=461; Antisense; CTACTACAATCCCTACTACAATGGC
>probe:Drosophila_2:1627954_a_at:198:69; Interrogation_Position=481; Antisense; ATGGCTACAACTACTACGGCGGATA
>probe:Drosophila_2:1627954_a_at:401:571; Interrogation_Position=540; Antisense; GGCTTTGGCGGCTATTCTGGCTATC
>probe:Drosophila_2:1627954_a_at:478:407; Interrogation_Position=590; Antisense; GACGGCTGGCGAGGTCGATAACCAA
>probe:Drosophila_2:1627954_a_at:146:455; Interrogation_Position=606; Antisense; GATAACCAACTTCCCGGTGCCGATG
>probe:Drosophila_2:1627954_a_at:510:107; Interrogation_Position=688; Antisense; AGAACTTCCTCGACGGCAGGAACAA
>probe:Drosophila_2:1627954_a_at:148:199; Interrogation_Position=711; Antisense; AACGCTAACGTTGTGCCACTTTATC
>probe:Drosophila_2:1627954_a_at:396:699; Interrogation_Position=730; Antisense; TTTATCACCTACTCCAAATGGCCAG
>probe:Drosophila_2:1627954_a_at:479:227; Interrogation_Position=746; Antisense; AATGGCCAGGGCTTGAAGTACTCTA
>probe:Drosophila_2:1627954_a_at:551:601; Interrogation_Position=809; Antisense; TGTATATTCCGAGTAACCGCGTGAT
>probe:Drosophila_2:1627954_a_at:665:131; Interrogation_Position=824; Antisense; ACCGCGTGATGCATTGTAGTTCTTA
>probe:Drosophila_2:1627954_a_at:157:679; Interrogation_Position=840; Antisense; TAGTTCTTACTTATCATCGCATGCG
>probe:Drosophila_2:1627954_a_at:624:347; Interrogation_Position=858; Antisense; GCATGCGTTCTAGTTTATAGCCCTA
>probe:Drosophila_2:1627954_a_at:396:395; Interrogation_Position=922; Antisense; GAAATCGTCCAACTGAAAGCCCATA

Paste this into a BLAST search page for me
CTACTACAATCCCTACTACAATGGCATGGCTACAACTACTACGGCGGATAGGCTTTGGCGGCTATTCTGGCTATCGACGGCTGGCGAGGTCGATAACCAAGATAACCAACTTCCCGGTGCCGATGAGAACTTCCTCGACGGCAGGAACAAAACGCTAACGTTGTGCCACTTTATCTTTATCACCTACTCCAAATGGCCAGAATGGCCAGGGCTTGAAGTACTCTATGTATATTCCGAGTAACCGCGTGATACCGCGTGATGCATTGTAGTTCTTATAGTTCTTACTTATCATCGCATGCGGCATGCGTTCTAGTTTATAGCCCTAGAAATCGTCCAACTGAAAGCCCATA

Full Affymetrix probeset data:

Annotations for 1627954_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime