FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627957_at:

>probe:Drosophila_2:1627957_at:109:57; Interrogation_Position=1004; Antisense; ATGACTGTTGCCGAAGTCCTGGACG
>probe:Drosophila_2:1627957_at:674:1; Interrogation_Position=1052; Antisense; ACTAACACGTTTCACTATACCTTCT
>probe:Drosophila_2:1627957_at:159:105; Interrogation_Position=1084; Antisense; AGACGCGGTTACTGAGGTGCTGCCT
>probe:Drosophila_2:1627957_at:658:63; Interrogation_Position=1127; Antisense; ATGTGGTACATCCATGGTCGCCGCA
>probe:Drosophila_2:1627957_at:218:65; Interrogation_Position=1140; Antisense; ATGGTCGCCGCAAGTTCATTGCCAG
>probe:Drosophila_2:1627957_at:210:299; Interrogation_Position=625; Antisense; CGCTCAGTCCGTCTTCAAGGTGGAA
>probe:Drosophila_2:1627957_at:304:561; Interrogation_Position=661; Antisense; GGAACAATCTCTCATCTACAAACTC
>probe:Drosophila_2:1627957_at:533:627; Interrogation_Position=732; Antisense; TGCCTCCCAACTGCATTTGGATGCA
>probe:Drosophila_2:1627957_at:438:545; Interrogation_Position=750; Antisense; GGATGCACGACTCCTTCCAGATGAG
>probe:Drosophila_2:1627957_at:691:49; Interrogation_Position=836; Antisense; ATGCGCAGTGCCCTGGAAATTAGCT
>probe:Drosophila_2:1627957_at:310:243; Interrogation_Position=853; Antisense; AATTAGCTGGGCAACAGCGTTCCTC
>probe:Drosophila_2:1627957_at:84:123; Interrogation_Position=868; Antisense; AGCGTTCCTCTACTGCAAGGCCAGA
>probe:Drosophila_2:1627957_at:507:103; Interrogation_Position=890; Antisense; AGACCCACGCTGGAGCACATATCGG
>probe:Drosophila_2:1627957_at:480:675; Interrogation_Position=919; Antisense; TAGCTTCCAGAAGCCGGTCAGCGTG

Paste this into a BLAST search page for me
ATGACTGTTGCCGAAGTCCTGGACGACTAACACGTTTCACTATACCTTCTAGACGCGGTTACTGAGGTGCTGCCTATGTGGTACATCCATGGTCGCCGCAATGGTCGCCGCAAGTTCATTGCCAGCGCTCAGTCCGTCTTCAAGGTGGAAGGAACAATCTCTCATCTACAAACTCTGCCTCCCAACTGCATTTGGATGCAGGATGCACGACTCCTTCCAGATGAGATGCGCAGTGCCCTGGAAATTAGCTAATTAGCTGGGCAACAGCGTTCCTCAGCGTTCCTCTACTGCAAGGCCAGAAGACCCACGCTGGAGCACATATCGGTAGCTTCCAGAAGCCGGTCAGCGTG

Full Affymetrix probeset data:

Annotations for 1627957_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720