FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627958_at:

>probe:Drosophila_2:1627958_at:472:431; Interrogation_Position=13; Antisense; GAGTCATTTTCCAGCGATTCACACA
>probe:Drosophila_2:1627958_at:138:125; Interrogation_Position=278; Antisense; AGCCCATGGACGTGCAGTGCCCGTA
>probe:Drosophila_2:1627958_at:522:461; Interrogation_Position=28; Antisense; GATTCACACACCCAGTTGGGCCAAA
>probe:Drosophila_2:1627958_at:336:355; Interrogation_Position=350; Antisense; GCACCCATCTGATAGCCTTGATATT
>probe:Drosophila_2:1627958_at:456:315; Interrogation_Position=364; Antisense; GCCTTGATATTATGCCTGTTCCAGT
>probe:Drosophila_2:1627958_at:456:93; Interrogation_Position=386; Antisense; AGTTGTACTGCTGTGTGTGTCTGCC
>probe:Drosophila_2:1627958_at:19:597; Interrogation_Position=401; Antisense; TGTGTCTGCCGTACTGCATTTCCAG
>probe:Drosophila_2:1627958_at:439:345; Interrogation_Position=416; Antisense; GCATTTCCAGTTGCATGAACACCAA
>probe:Drosophila_2:1627958_at:371:651; Interrogation_Position=441; Antisense; TCACTACTGTGGCATGTGCGATCGT
>probe:Drosophila_2:1627958_at:722:619; Interrogation_Position=457; Antisense; TGCGATCGTTATTTGGGCACCTACG
>probe:Drosophila_2:1627958_at:707:525; Interrogation_Position=471; Antisense; GGGCACCTACGATCGCAAATGAGCA
>probe:Drosophila_2:1627958_at:715:523; Interrogation_Position=512; Antisense; GGGCGACCTGTTCATGTGTACATAT
>probe:Drosophila_2:1627958_at:624:35; Interrogation_Position=55; Antisense; ATCATGGATTCCGTCTATCCAGCTG
>probe:Drosophila_2:1627958_at:152:311; Interrogation_Position=95; Antisense; CCAAGGGATCCGTCGAGCTGCAGGC

Paste this into a BLAST search page for me
GAGTCATTTTCCAGCGATTCACACAAGCCCATGGACGTGCAGTGCCCGTAGATTCACACACCCAGTTGGGCCAAAGCACCCATCTGATAGCCTTGATATTGCCTTGATATTATGCCTGTTCCAGTAGTTGTACTGCTGTGTGTGTCTGCCTGTGTCTGCCGTACTGCATTTCCAGGCATTTCCAGTTGCATGAACACCAATCACTACTGTGGCATGTGCGATCGTTGCGATCGTTATTTGGGCACCTACGGGGCACCTACGATCGCAAATGAGCAGGGCGACCTGTTCATGTGTACATATATCATGGATTCCGTCTATCCAGCTGCCAAGGGATCCGTCGAGCTGCAGGC

Full Affymetrix probeset data:

Annotations for 1627958_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720