FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627962_at:

>probe:Drosophila_2:1627962_at:502:595; Interrogation_Position=213; Antisense; TGTGTGCCCCATTTGCTGAAAGCAG
>probe:Drosophila_2:1627962_at:182:687; Interrogation_Position=264; Antisense; TATATATCCTTACCACACTTTGCTC
>probe:Drosophila_2:1627962_at:599:619; Interrogation_Position=284; Antisense; TGCTCTCAAATAGTTGCTCTCTCAA
>probe:Drosophila_2:1627962_at:137:475; Interrogation_Position=313; Antisense; GTTACACAAATCTCAAAAGGCGCAC
>probe:Drosophila_2:1627962_at:198:233; Interrogation_Position=376; Antisense; AATGCAACAATTTACCTTAGGCCAA
>probe:Drosophila_2:1627962_at:457:657; Interrogation_Position=408; Antisense; TAAGTGACCAATTTTCGCGAAATCG
>probe:Drosophila_2:1627962_at:496:327; Interrogation_Position=432; Antisense; GCGATTCTCTCAAACCCTTGAATTT
>probe:Drosophila_2:1627962_at:122:615; Interrogation_Position=450; Antisense; TGAATTTCCCTTTGTCCACTCGAAA
>probe:Drosophila_2:1627962_at:167:505; Interrogation_Position=553; Antisense; GTCCAGCAATATTGATGTTCATCCA
>probe:Drosophila_2:1627962_at:646:211; Interrogation_Position=596; Antisense; AAGAGCTGCCAGCATTTTGCATTTT
>probe:Drosophila_2:1627962_at:307:345; Interrogation_Position=607; Antisense; GCATTTTGCATTTTGCGTTTTCTAA
>probe:Drosophila_2:1627962_at:93:245; Interrogation_Position=654; Antisense; AATTTCAATCAATTCGAACGCGGCG
>probe:Drosophila_2:1627962_at:566:635; Interrogation_Position=667; Antisense; TCGAACGCGGCGAACAACGCAAATT
>probe:Drosophila_2:1627962_at:160:15; Interrogation_Position=723; Antisense; ATTAGTTATCCGCTTCACACTTGTG

Paste this into a BLAST search page for me
TGTGTGCCCCATTTGCTGAAAGCAGTATATATCCTTACCACACTTTGCTCTGCTCTCAAATAGTTGCTCTCTCAAGTTACACAAATCTCAAAAGGCGCACAATGCAACAATTTACCTTAGGCCAATAAGTGACCAATTTTCGCGAAATCGGCGATTCTCTCAAACCCTTGAATTTTGAATTTCCCTTTGTCCACTCGAAAGTCCAGCAATATTGATGTTCATCCAAAGAGCTGCCAGCATTTTGCATTTTGCATTTTGCATTTTGCGTTTTCTAAAATTTCAATCAATTCGAACGCGGCGTCGAACGCGGCGAACAACGCAAATTATTAGTTATCCGCTTCACACTTGTG

Full Affymetrix probeset data:

Annotations for 1627962_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720