Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627967_a_at:

>probe:Drosophila_2:1627967_a_at:314:277; Interrogation_Position=1116; Antisense; CTATGGCCCGATGCTGTTGCTAATC
>probe:Drosophila_2:1627967_a_at:230:657; Interrogation_Position=1154; Antisense; TAATGTTTGTCCTTTCGGCGATTTA
>probe:Drosophila_2:1627967_a_at:306:63; Interrogation_Position=1199; Antisense; ATGTGAAAGGCCTTGTCCACAAGCA
>probe:Drosophila_2:1627967_a_at:54:167; Interrogation_Position=1253; Antisense; AAATGTTTGCTATATTCCTGCGACT
>probe:Drosophila_2:1627967_a_at:596:9; Interrogation_Position=1266; Antisense; ATTCCTGCGACTTTTCATCTTAATG
>probe:Drosophila_2:1627967_a_at:129:645; Interrogation_Position=1283; Antisense; TCTTAATGGGTTTGTCGTGGAGCTT
>probe:Drosophila_2:1627967_a_at:628:79; Interrogation_Position=1351; Antisense; AGGGCTTTAATGGTGGCTGACTACT
>probe:Drosophila_2:1627967_a_at:192:571; Interrogation_Position=1365; Antisense; GGCTGACTACTTTAATTGGTCCCAG
>probe:Drosophila_2:1627967_a_at:478:267; Interrogation_Position=1387; Antisense; CAGGGTACCATCATATTCGTGCTTT
>probe:Drosophila_2:1627967_a_at:135:471; Interrogation_Position=906; Antisense; GTTTAGTCTAGCCTCTAACTGTTTG
>probe:Drosophila_2:1627967_a_at:129:661; Interrogation_Position=921; Antisense; TAACTGTTTGCACCGATTGCTGCCA
>probe:Drosophila_2:1627967_a_at:159:7; Interrogation_Position=936; Antisense; ATTGCTGCCAGAAAATCCGTTCCGT
>probe:Drosophila_2:1627967_a_at:148:203; Interrogation_Position=949; Antisense; AATCCGTTCCGTGCATACAACTTAT
>probe:Drosophila_2:1627967_a_at:202:531; Interrogation_Position=981; Antisense; GGGTATACCGCTAATCATGACTGCA

Paste this into a BLAST search page for me
CTATGGCCCGATGCTGTTGCTAATCTAATGTTTGTCCTTTCGGCGATTTAATGTGAAAGGCCTTGTCCACAAGCAAAATGTTTGCTATATTCCTGCGACTATTCCTGCGACTTTTCATCTTAATGTCTTAATGGGTTTGTCGTGGAGCTTAGGGCTTTAATGGTGGCTGACTACTGGCTGACTACTTTAATTGGTCCCAGCAGGGTACCATCATATTCGTGCTTTGTTTAGTCTAGCCTCTAACTGTTTGTAACTGTTTGCACCGATTGCTGCCAATTGCTGCCAGAAAATCCGTTCCGTAATCCGTTCCGTGCATACAACTTATGGGTATACCGCTAATCATGACTGCA

Full Affymetrix probeset data:

Annotations for 1627967_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime